2024-05-15 18:27:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001130608 794 bp mRNA linear VRT 13-MAR-2023 DEFINITION Danio rerio SIX homeobox 9 (six9), mRNA. ACCESSION NM_001130608 XM_684623 VERSION NM_001130608.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 794) AUTHORS Kubra K, Gaddu GK, Liongue C, Heidary S, Ward AC, Dhillon AS and Basheer F. TITLE Phylogenetic and Expression Analysis of Fos Transcription Factors in Zebrafish JOURNAL Int J Mol Sci 23 (17), 10098 (2022) PUBMED 36077499 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 794) AUTHORS Seo HC, Curtiss J, Mlodzik M and Fjose A. TITLE Six class homeobox genes in drosophila belong to three distinct families and are involved in head development JOURNAL Mech Dev 83 (1-2), 127-139 (1999) PUBMED 10381573 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from BC163024.1. On May 28, 2009 this sequence version replaced XM_684623.3. ##Evidence-Data-START## Transcript exon combination :: BC163024.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2168447, SAMEA4476780 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..794 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="18" /map="18" gene 1..794 /gene="six9" /gene_synonym="si:dkey-149j18.3" /note="SIX homeobox 9" /db_xref="GeneID:30623" /db_xref="ZFIN:ZDB-GENE-990621-11" exon 1..437 /gene="six9" /gene_synonym="si:dkey-149j18.3" /inference="alignment:Splign:2.1.0" CDS 30..737 /gene="six9" /gene_synonym="si:dkey-149j18.3" /note="sine oculis homeobox homolog 9" /codon_start=1 /product="SIX homeobox 9" /protein_id="NP_001124080.1" /db_xref="GeneID:30623" /db_xref="ZFIN:ZDB-GENE-990621-11" /translation="
MAMGFSPEQVACVCEVLLQSGSMDRLSSFLCSLPSISTSSNMYMGFGQSQESVLKARAAVAFHHCRFTELYALLEGNVFSPRSHPLLQQLWLRAHYMEAELQRGRPLGAVGKYRIRRKFPLPRTIWDGEETSYCFKEKSRSVLREWYCRKPYPSPREKRDLAAATGLTATQVSNWFKNRRQRDRAATSRQGTSAGAFLSSDEEISPPGSPRTLFSCSQQLSAHPPPLRHLGPAHY"
misc_feature 42..395 /gene="six9" /gene_synonym="si:dkey-149j18.3" /note="Transcriptional regulator, SIX1, N-terminal SD domain; Region: SIX1_SD; pfam16878" /db_xref="CDD:435624" misc_feature 426..581 /gene="six9" /gene_synonym="si:dkey-149j18.3" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(429..431,549..551,558..563,570..572) /gene="six9" /gene_synonym="si:dkey-149j18.3" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 438..601 /gene="six9" /gene_synonym="si:dkey-149j18.3" /inference="alignment:Splign:2.1.0" exon 602..794 /gene="six9" /gene_synonym="si:dkey-149j18.3" /inference="alignment:Splign:2.1.0" ORIGIN
tgggacctttcaggatctttggtccagagatggcgatgggcttctcacctgagcaggtggcgtgtgtttgtgaggttcttctccaaagtggaagcatggatcgcttgtcttcattcttatgctctttaccttcaatctccacatcatccaacatgtatatgggttttggccagagtcaggagagtgtgttgaaagcacgtgctgcggtcgccttccaccactgccgttttacagagctgtatgccttgttagagggtaacgtgttttccccgcgcagtcaccctctcctccagcagctgtggctccgggctcactacatggaggctgaactgcagcggggccgccctcttggggctgtgggaaagtatcgcatacgccgaaagttccctcttcctcgcaccatctgggatggagaggagaccagctactgcttcaaggaaaagtctcgaagtgtgctgagagagtggtactgcagaaagccgtatccctcgccgcgagaaaaacgagatttggctgcagccaccggactgacagctacacaagtcagtaactggttcaagaaccgccgccagcgggacagagctgcgaccagccgccaaggaacttcagcaggagcgttcttgagttcagatgaggagatctctcctccaggaagccccagaacactgttctcctgctcccagcagctctctgcccacccacctcctctccgccatctgggacctgcacactactgagtgcactggaacacaggtcaaacaacagcaatctaatgtgctgcaagcatgtttgtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]