GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-15 11:10:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001113526             849 bp    mRNA    linear   VRT 05-AUG-2023
DEFINITION  Danio rerio H6 family homeobox 1 (hmx1), mRNA.
ACCESSION   NM_001113526 XM_001334293
VERSION     NM_001113526.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 849)
  AUTHORS   El Fersioui Y, Pinton G, Allaman-Pillet N and Schorderet DF.
  TITLE     Premature Vertebral Mineralization in hmx1-Mutant Zebrafish
  JOURNAL   Cells 11 (7), 1088 (2022)
   PUBMED   35406651
  REMARK    GeneRIF: Premature Vertebral Mineralization in hmx1-Mutant
            Zebrafish.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 849)
  AUTHORS   Spead O, Weaver CJ, Moreland T and Poulain FE.
  TITLE     Live imaging of retinotectal mapping reveals topographic map
            dynamics and a previously undescribed role for Contactin 2 in map
            sharpening
  JOURNAL   Development 148 (22) (2021)
   PUBMED   34698769
REFERENCE   3  (bases 1 to 849)
  AUTHORS   Farnsworth DR, Posner M and Miller AC.
  TITLE     Single cell transcriptomics of the developing zebrafish lens and
            identification of putative controllers of lens development
  JOURNAL   Exp Eye Res 206, 108535 (2021)
   PUBMED   33705730
REFERENCE   4  (bases 1 to 849)
  AUTHORS   El Fersioui Y, Pinton G, Allaman-Pillet N and Schorderet DF.
  TITLE     Hmx1 regulates urfh1 expression in the craniofacial region in
            zebrafish
  JOURNAL   PLoS One 16 (1), e0245239 (2021)
   PUBMED   33465110
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 849)
  AUTHORS   England SJ, Cerda GA, Kowalchuk A, Sorice T, Grieb G and Lewis KE.
  TITLE     Hmx3a Has Essential Functions in Zebrafish Spinal Cord, Ear and
            Lateral Line Development
  JOURNAL   Genetics 216 (4), 1153-1185 (2020)
   PUBMED   33077489
REFERENCE   6  (bases 1 to 849)
  AUTHORS   Boisset G and Schorderet DF.
  TITLE     Zebrafish hmx1 promotes retinogenesis
  JOURNAL   Exp Eye Res 105, 34-42 (2012)
   PUBMED   23068565
REFERENCE   7  (bases 1 to 849)
  AUTHORS   Gongal PA, March LD, Holly VL, Pillay LM, Berry-Wynne KM, Kagechika
            H and Waskiewicz AJ.
  TITLE     Hmx4 regulates Sonic hedgehog signaling through control of retinoic
            acid synthesis during forebrain patterning
  JOURNAL   Dev Biol 355 (1), 55-64 (2011)
   PUBMED   21539831
REFERENCE   8  (bases 1 to 849)
  AUTHORS   Feng Y and Xu Q.
  TITLE     Pivotal role of hmx2 and hmx3 in zebrafish inner ear and lateral
            line development
  JOURNAL   Dev Biol 339 (2), 507-518 (2010)
   PUBMED   20043901
REFERENCE   9  (bases 1 to 849)
  AUTHORS   Wotton KR, Weierud FK, Juarez-Morales JL, Alvares LE, Dietrich S
            and Lewis KE.
  TITLE     Conservation of gene linkage in dispersed vertebrate NK homeobox
            clusters
  JOURNAL   Dev Genes Evol 219 (9-10), 481-496 (2009)
   PUBMED   20112453
REFERENCE   10 (bases 1 to 849)
  AUTHORS   Schorderet DF, Nichini O, Boisset G, Polok B, Tiab L, Mayeur H,
            Raji B, de la Houssaye G, Abitbol MM and Munier FL.
  TITLE     Mutation in the human homeobox gene NKX5-3 causes an
            oculo-auricular syndrome
  JOURNAL   Am J Hum Genet 82 (5), 1178-1184 (2008)
   PUBMED   18423520
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from EU050652.1.
            
            On Jan 17, 2008 this sequence version replaced XM_001334293.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: EU050652.1, EU203551.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2168447, SAMEA3505370
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..849
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="London AB"
                     /db_xref="taxon:7955"
                     /chromosome="1"
                     /map="1"
     gene            1..849
                     /gene="hmx1"
                     /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164"
                     /note="H6 family homeobox 1"
                     /db_xref="GeneID:797503"
                     /db_xref="ZFIN:ZDB-GENE-080204-54"
     CDS             1..849
                     /gene="hmx1"
                     /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164"
                     /note="homeobox transcription factor SOHo; H6 homeo box 1"
                     /codon_start=1
                     /product="homeobox protein HMX1"
                     /protein_id="NP_001106998.1"
                     /db_xref="GeneID:797503"
                     /db_xref="ZFIN:ZDB-GENE-080204-54"
                     /translation="
MHEKSQQQHTSTTSRGSSFFIENLLGSCRTEKPVCPIKDNDGTERANALKRYPNAYRKEMCVQASSAGFKTEISPLEWKGRETSRSPREESRNSSEYSRSDRDTPLASEPLDGVVDRKMSGCAVDEGDDARQLFDERSGPDTSEPGSARKKKTRTVFSRSQVFQLESTFDMKRYLSSSERAGLAASLHLTETQVKIWFQNRRNKWKRQLAADLEAVNFNHNSQRIVRVPILYHDKATPMSTLSFNVSQVSPPLMGFSNSVNYPLSSFAHSVNLMTSQMTGLV"
     misc_feature    order(451..465,469..471,520..522,538..540,577..579,
                     583..588,595..600,604..612,616..621)
                     /gene="hmx1"
                     /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    457..618
                     /gene="hmx1"
                     /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(457..459,466..468,586..588,595..600,607..609)
                     /gene="hmx1"
                     /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..256
                     /gene="hmx1"
                     /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164"
                     /inference="alignment:Splign:2.1.0"
     exon            257..849
                     /gene="hmx1"
                     /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgcatgaaaaaagccagcaacagcacacttccaccacatccaggggctcgtcgttttttatcgagaatttgcttggctcttgtaggacagaaaagcctgtctgtccaataaaggataacgatggcacggagagagcgaatgctctcaagcgctacccgaacgcatatcggaaagaaatgtgcgttcaagcgtccagcgcgggcttcaagacggagatctcgccgctggagtggaaaggacgcgaaacctccaggagtccaagagaggaaagccgcaattccagtgaatattcccgcagcgacagagacacccctttggcctctgagcctcttgatggagtagtggaccgaaaaatgagcggttgtgcggttgacgagggtgacgacgctcgacagctcttcgatgagcgttcggggccagacacttccgaacccggctcagcccgaaagaaaaagacccgaactgtgttcagcagaagccaggttttccagctagagtccacattcgacatgaagagatacctcagcagctctgagcgcgcggggctcgcggcctccctgcacctgaccgagacccaggtgaaaatctggtttcaaaaccgccgaaacaaatggaaaagacaactggccgcggatttagaggctgttaattttaaccacaactctcagcggattgtacgggtgccgatcttgtaccacgataaagctacacccatgtcgacactcagttttaacgtgtctcaagtctcgccaccattaatgggcttttcaaattcagtgaactatccattgtcgtcctttgctcattcagtgaatttaatgacatcgcagatgacaggccttgtctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]