2024-05-17 14:45:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_026835121 955 bp mRNA linear INV 22-OCT-2018 DEFINITION PREDICTED: Ciona intestinalis glutamate receptor-interacting protein 1-like (LOC108949604), mRNA. ACCESSION XM_026835121 VERSION XM_026835121.1 DBLINK BioProject: PRJNA187185 KEYWORDS RefSeq; includes ab initio. SOURCE Ciona intestinalis (vase tunicate) ORGANISM Ciona intestinalis Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia; Cionidae; Ciona. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_020172.2) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ciona intestinalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 4% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..955 /organism="Ciona intestinalis" /mol_type="mRNA" /db_xref="taxon:7719" /chromosome="7" gene 1..955 /gene="LOC108949604" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, and 94% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:108949604" CDS 110..955 /gene="LOC108949604" /codon_start=1 /product="glutamate receptor-interacting protein 1-like" /protein_id="XP_026690922.1" /db_xref="GeneID:108949604" /translation="
MGSNQSKSNSRKSHSDLYYHHGKLTLKERLSVLKTGSLKRNHQLRKDELTESDLAIYATKKWNSETTLDARTGGNQGPITEEDLQVVPARVEEIPEDERGEATVNLVKVDGVPLGLTVSGGADKDGRPRVSNLRSTGIAARSDQLQVGDIITSVNGIRSTKLKHGEIISLLKNISEKVCLEIEYLLPPTTVQTSTIIQKTTEVFLQKEHGSFGFVLRGGNHGQHCRSRPLVVTHIRPDSPAAREGTLKTGDRIISIGSTPLIGGTLQEVITLEKAKYLWLF"
misc_feature 416..658 /gene="LOC108949604" /note="PDZ domain found in a variety of Eumetazoan signaling molecules, often in tandem arrangements. May be responsible for specific protein-protein interactions, as most PDZ domains bind C-terminal polypeptides, and binding to internal (non-C-terminal)...; Region: PDZ_signaling; cd00992" /db_xref="CDD:238492" misc_feature order(446..457,461..463,608..613,620..625) /gene="LOC108949604" /note="protein binding site [polypeptide binding]; other site" /db_xref="CDD:238492" misc_feature 707..925 /gene="LOC108949604" /note="PDZ domain found in a variety of Eumetazoan signaling molecules, often in tandem arrangements. May be responsible for specific protein-protein interactions, as most PDZ domains bind C-terminal polypeptides, and binding to internal (non-C-terminal)...; Region: PDZ_signaling; cd00992" /db_xref="CDD:238492" ORIGIN
gccttttattcatatttaccaccatacgtttagtgtatagggcttaatgtatgctgtgtaattgattaaaaatgctataggattactattggtaaccaaccttctaaacatggggagtaaccaaagcaaaagtaacagccgcaagtcccacagtgacttatattaccaccatggtaaacttactttgaaagaaagattgagtgttctaaaaactggttctctaaaacggaaccatcagctccgtaaggatgaacttaccgaatccgaccttgcaatatatgctacaaagaaatggaatagcgaaaccactttagatgcacgcacaggtggtaaccaaggaccaatcacagaagaggatttacaagttgttccagcaagagtggaagaaataccagaggatgaacgtggtgaagccacagtgaacttggttaaagttgatggcgttccacttggactcactgtttctggtggagcggataaagatggccgccctcgtgtgtctaatctacgtagcactggcatcgctgcaaggagtgaccaattacaagttggtgacatcataacttcagtgaatggaattcggtctacgaaactaaaacacggggaaattatcagtttgttgaaaaatatcagcgaaaaagtttgtttggagattgaatatcttctcccacctacaactgtccagacatcaactatcattcaaaagacgacggaggttttcctccagaaagaacacggatcgtttggattcgttctacggggtggtaaccatggccaacactgcaggtcacgacctctggtggttacgcatatacgacccgattcacctgcagcaagagaaggaaccttaaagacgggtgatcgaattatttcaatcgggtcgaccccgctcatcggtggcaccttacaggaagttataacactcgaaaaggcaaaatatttatggctgttttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]