2024-05-17 11:48:24, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018811111 1908 bp mRNA linear INV 22-OCT-2018 DEFINITION PREDICTED: Ciona intestinalis homeobox protein 10 (LOC778737), mRNA. ACCESSION XM_018811111 VERSION XM_018811111.2 DBLINK BioProject: PRJNA187185 KEYWORDS RefSeq. SOURCE Ciona intestinalis (vase tunicate) ORGANISM Ciona intestinalis Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia; Cionidae; Ciona. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_020166.2) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Oct 22, 2018 this sequence version replaced XM_018811111.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ciona intestinalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1908 /organism="Ciona intestinalis" /mol_type="mRNA" /db_xref="taxon:7719" /chromosome="1" gene 1..1908 /gene="LOC778737" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 9 ESTs, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 17 samples with support for all annotated introns" /db_xref="GeneID:778737" CDS 192..1634 /gene="LOC778737" /codon_start=1 /product="homeobox protein 10" /protein_id="XP_018666656.1" /db_xref="GeneID:778737" /translation="
MFVAGCRYFTSNGGLVRTVLIADKKELPTCIWVMTEHSTARSFTVSCLLNLADEKATYAPGLNCKWPAMETESPDLTCSETNGENTAVFRPSCDIAKDSSAENTDHYTPRVHSSFPMHQSQTETLPQCVRAKQHSWGTETKAHDRGNWNPAFPSCAYARPEYTEHCTPCTDDPTELSMACENPKPEVKRLERLDKACEQARENSINTTEERSSWHDPHTSSLHTESASHESSPPSNGSPSAVKDTTESKACPDYDVLPYQNMTNNNKGDHDVFNPFMTSHGHHTDDASGHGGVSVPRKKQRRTRTTFNSGQLAALERVFERTHYPDAFVREELARRVGLSEARVQVWFQNRRAKFRRAERSLLTSRMAMRHPLHHHVTSQDNSACLSSSVCRTQPILPSISDNMLTRHNSLLAQGSNPLCDPQIPMVPPNHFFQWSAPPMKPFPCSGGQPVVNVEHGNYVGDTFSQLKMQGMTFQRGFLQ"
misc_feature order(1092..1106,1110..1112,1161..1163,1179..1181, 1218..1220,1224..1229,1236..1241,1245..1253,1257..1262) /gene="LOC778737" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 1098..1259 /gene="LOC778737" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(1098..1100,1107..1109,1227..1229,1236..1241, 1248..1250) /gene="LOC778737" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" ORIGIN
tctcgcgtggggacaaaatatttcacacaactaagcgattataattaagttatcacgctgtaaacgacgtccagttacctattctaagatataagtgttttttaaagatgtaatgcattatttaaccgagtaattgtacacattgttacaccttactgttgggatggttatatatatgtacacaaatactaatgtttgttgcagggtgtagatactttacaagcaatggtggtttagtaagaacggtgcttatagcagataagaaggaattgccaacttgcatttgggttatgacagaacattcaacagcaagaagtttcactgtgagctgtttactcaacttggccgacgaaaaagcgacttacgctccgggattgaattgtaaatggccggcgatggaaactgaaagtcccgatcttacgtgctcagaaactaacggtgaaaacactgctgtatttcgaccgagctgcgatatagcaaaggattcgagtgctgaaaatacggatcattacaccccgagggttcattctagttttcctatgcaccaatcccaaactgaaacattgccccaatgtgtacgagcaaagcagcacagctggggaacggaaacaaaagcgcatgatcgcgggaactggaaccctgctttcccgtcatgtgcttacgcgaggcctgagtacactgaacattgtaccccgtgcacggacgatcctacggaactatccatggcttgcgagaatcctaaacctgaagtcaagcggttggaaagactggacaaggcttgcgagcaggcgcgggaaaattcaatcaacacaactgaagagagaagcagttggcatgatccacatacatcaagtttacatacagagtcggcatctcatgagagctcgccaccttcaaatggaagtccctctgctgtcaaagacaccacggaatctaaggcatgtcccgactatgacgtattaccatatcaaaatatgacgaacaacaacaaaggcgatcatgacgttttcaatccctttatgacgtcacacggccaccacaccgatgacgcaagcggacatgggggagtctcggttccgaggaaaaaacaaagacggacacgcacgacctttaacagcggacagctggcagctctggagcgagtttttgaacgaacacattatcctgacgcgtttgtgagagaggaacttgcgcgacgggtcgggctgagtgaggccagggttcaggtttggttccaaaatcgaagagcaaagtttcgacgagcagaacgctcacttctgacgtcacgcatggcgatgcgtcatccattacatcatcatgtgacgtcacaagataactcggcgtgtttgtcttcgtcagtttgcagaactcaaccaatccttccatccatcagcgacaacatgctgaccagacacaactcgttgctggcccaaggttcgaatcccctgtgcgaccctcaaataccaatggtgcctccaaaccactttttccaatggtcggcaccaccaatgaaaccatttccatgttccggtggccaacctgttgttaacgtcgaacacggaaattacgtaggagatactttctcccaacttaagatgcaaggtatgacgtttcaaagaggattcttacaatgaataatacaacagaagtgtttgtgacgcgtataaagattcgtagctgcctattgaatcatctcagaacgtacattcatgggtgtagttgatgccttattattattttttcagttagttccgcttttaaaaattgtgtttgttttctgaaagttcacgtagccttgcgatttctgtgtaccttttgggtaactctgttttgtctattttattttgcctatttaccgtctgtattactcgctgctagttcatgaataaagtcgccaagtcagctgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]