2024-05-18 15:55:04, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_171525 3218 bp mRNA linear INV 22-NOV-2023 DEFINITION Caenorhabditis elegans Piwi domain-containing protein (rde-1), mRNA. ACCESSION NM_171525 VERSION NM_171525.7 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 3218) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 3218) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-NOV-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 3218) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (29-OCT-2023) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 3218) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003283). On Feb 2, 2021 this sequence version replaced NM_171525.6. FEATURES Location/Qualifiers source 1..3218 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="V" gene 1..3218 /gene="rde-1" /locus_tag="CELE_K08H10.7" /db_xref="GeneID:179393" /db_xref="WormBase:WBGene00004323" CDS 29..3091 /gene="rde-1" /locus_tag="CELE_K08H10.7" /standard_name="K08H10.7" /note="Confirmed by transcript evidence" /codon_start=1 /product="Piwi domain-containing protein" /protein_id="NP_741611.1" /db_xref="EnsemblGenomes-Gn:WBGene00004323" /db_xref="EnsemblGenomes-Tr:K08H10.7" /db_xref="GeneID:179393" /db_xref="GOA:G5EEH0" /db_xref="InterPro:IPR003165" /db_xref="InterPro:IPR012337" /db_xref="InterPro:IPR036085" /db_xref="InterPro:IPR036397" /db_xref="UniProtKB/TrEMBL:G5EEH0" /db_xref="WormBase:WBGene00004323" /translation="
MSSNFPELEKGFYRHSLDPEMKWLARPTGKCDGKFYEKKVLLLVNWFKFSSKIYDREYYEYEVKMTKEVLNRKPGKPFPKKTEIPIPDRAKLFWQHLRHEKKQTDFILEDYVFDEKDTVYSVCRLNTVTSKMLVSEKVVKKDSEKKDEKDLEKKILYTMILTYRKKFHLNFSRENPEKDEEANRSYKFLKNVMTQKVRYAPFVNEEIKVQFAKNFVYDNNSILRVPESFHDPNRFEQSLEVAPRIEAWFGIYIGIKELFDGEPVLNFAIVDKLFYNAPKMSLLDYLLLIVDPQSCNDDVRKDLKTKLMAGKMTIRQAARPRIRQLLENLKLKCAEVWDNEMSRLTERHLTFLDLCEENSLVYKVTGKSDRGRNAKKYDTTLFKIYEENKKFIEFPHLPLVKVKSGAKEYAVPMEHLEVHEKPQRYKNRIDLVMQDKFLKRATRKPHDYKENTLKMLKELDFSSEELNFVERFGLCSKLQMIECPGKVLKEPMLVNSVNEQIKMTPVIRGFQEKQLNVVPEKELCCAVFVVNETAGNPCLEENDVVKFYTELIGGCKFRGIRIGANENRGAQSIMYDATKNEYAFYKNCTLNTGIGRFEIAATEAKNMFERLPDKEQKVLMFIIISKRQLNAYGFVKHYCDHTIGVANQHITSETVTKALASLRHEKGSKRIFYQIALKINAKLGGINQELDWSEIAEISPEEKERRKTMPLTMYVGIDVTHPTSYSGIDYSIAAVVASINPGGTIYRNMIVTQEECRPGERAVAHGRERTDILEAKFVKLLREFAENNDNRAPAHIVVYRDGVSDSEMLRVSHDELRSLKSEVKQFMSERDGEDPEPKYTFIVIQKRHNTRLLRRMEKDKPVVNKDLTPAETDVAVAAVKQWEEDMKESKETGIVNPSSGTTVDKLIVSKYKFDFFLASHHGVLGTSRPGHYTVMYDDKGMSQDEVYKMTYGLAFLSARCRKPISLPVPVHYAHLSCEKAKELYRTYKEHYIGDYAQPRTRHEMEHFLQTNVKYPGMSFA"
misc_feature 866..1285 /gene="rde-1" /locus_tag="CELE_K08H10.7" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1073..1075,1118..1120,1169..1171,1181..1183, 1232..1234,1253..1255,1259..1261) /gene="rde-1" /locus_tag="CELE_K08H10.7" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1427..2974 /gene="rde-1" /locus_tag="CELE_K08H10.7" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1922..1924,1934..1936,1970..1981,1988..1990, 2039..2041,2048..2050,2060..2062,2072..2074) /gene="rde-1" /locus_tag="CELE_K08H10.7" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2180..2182,2186..2188,2429..2431,2948..2950) /gene="rde-1" /locus_tag="CELE_K08H10.7" /note="active site" /db_xref="CDD:240015" ORIGIN
ataatcaacagccacaaagtgatgaaacatgtcctcgaattttcccgaattggaaaaaggattttatcgtcattctctcgatccggagatgaaatggcttgcgaggcccactggtaaatgcgacggcaaattctatgagaagaaagtacttcttttggtaaattggttcaagttctccagcaaaatttacgatcgggaatactacgagtatgaagtgaaaatgacaaaggaagtattgaatagaaaaccaggaaaacctttcccaaaaaagacagaaattccaattcccgatcgtgcaaaactcttctggcaacatcttcggcatgagaagaagcagacagattttattctcgaagactatgtttttgatgaaaaggacactgtttatagtgtttgtcgactgaacactgtcacatcaaaaatgctggtttcggagaaagtagtaaaaaaggattcggagaaaaaagatgaaaaggatttggagaaaaaaatcttatacacaatgatacttacctatcgtaaaaaatttcacctgaactttagtcgagaaaatccggaaaaagacgaagaagcgaatcggagttacaaattcctgaagaatgttatgacccagaaagttcgctacgcgccttttgtgaacgaggagattaaagtacaattcgcgaaaaattttgtgtacgataataattcaattctgcgagttcctgaatcgtttcacgatccaaacagattcgaacaatcattagaagtagcaccaagaatcgaagcatggtttggaatttacattggaatcaaagaattgttcgatggtgaacctgtgctcaattttgcaattgtcgataaactattctacaatgcaccgaaaatgtctcttctggattatcttctcctaattgtcgacccccagtcgtgtaacgatgatgtacgaaaagatcttaaaacaaaactgatggcgggaaaaatgacaatcagacaagccgcgcggccaagaattcgacaattattggaaaatttgaagctgaaatgcgcagaagtttgggataacgaaatgtcgagattgacagaacgacatctgacatttctagatttgtgcgaggaaaactctcttgtttataaagtcactggtaaatcggacagaggaagaaatgcaaaaaagtacgatactacattgttcaaaatctatgaggaaaacaaaaagttcattgagtttccccacctaccactagtcaaagttaaaagtggagcaaaagaatacgctgtaccaatggaacatcttgaagttcatgagaagccacaaagatacaagaatcgaattgatctggtgatgcaagacaagtttctaaagcgagctacacgaaaacctcacgactacaaagaaaataccctaaaaatgctgaaagaattggatttctcttctgaagagctaaattttgttgaaagatttggattatgctccaaacttcagatgatcgaatgtccaggaaaggttttgaaagagccaatgcttgtgaatagtgtaaatgaacaaattaaaatgacaccagtgattcgtggatttcaagaaaaacaattgaatgtggttcccgaaaaagaactttgctgtgctgtttttgtagtcaacgaaacagcgggaaatccatgcttagaagagaacgacgttgttaagttctacaccgaactaattggtggttgcaagttccgtggaatacgaattggtgccaatgaaaacagaggagcgcaatctattatgtacgacgcgacgaaaaatgaatatgccttctacaaaaattgtacactaaataccggaatcggtagatttgaaatagccgcaacagaagcgaagaatatgtttgaacgtcttcccgataaagaacaaaaagtcttaatgttcattatcatttccaaacgacaactgaatgcttacggttttgtgaaacattattgcgatcacaccatcggtgtagctaatcagcatattacttctgaaacagtcacaaaagctttggcatcactaaggcacgagaaaggatcaaaacgaattttctatcaaattgcattgaaaatcaacgcgaaattaggaggtattaaccaggagcttgactggtcagaaattgcagaaatatcaccagaagaaaaagaaagacggaaaacaatgccattaactatgtatgttggaattgatgtaactcatccaacctcctacagtggaattgattattctatagcggctgtagtagcgagtatcaatccaggtggaactatctatcgaaatatgattgtgactcaagaagaatgtcgtcccggtgagcgtgcagtggctcatggacgggaaagaacagatattttggaagcaaagttcgtgaaattgctcagagaattcgcagaaaacaacgacaatcgagcaccagcgcatattgtagtctatcgagacggagttagcgattcggagatgctacgtgttagtcatgatgagcttcgatctttaaaaagcgaagtaaaacaattcatgtcggaacgggatggagaagatccagagccgaagtacacgttcattgtgattcagaaaagacacaatacacgattgcttcgaagaatggaaaaagataagccagtggtcaataaagatcttactcctgctgaaacagatgtcgctgttgctgctgttaaacaatgggaggaggatatgaaagaaagcaaagaaactggaattgtgaacccatcatccggaacaactgtggataaacttatcgtttcgaaatacaaattcgattttttcttggcatctcatcatggtgtccttggtacatctcgtccaggacattacactgttatgtatgacgataaaggaatgagccaagatgaagtctataaaatgacctacggacttgcttttctctctgctagatgtcgaaaacccatctcgttgcctgttccggttcattatgctcatttatcatgtgaaaaagcgaaagagctttatcgaacttacaaggaacattacatcggtgactatgcacagccacggactcgacacgaaatggaacattttctccaaactaacgtgaagtaccctggaatgtcgttcgcataacattttgcaaaagtgtcgcccgtttcaatcaaatttttcaattgtagatattgtacttacttttttttaaagcccggtttcaaaaattcattccatgactaacgttttcataaattacttgaaattt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]