GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 13:39:19, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_069816               3268 bp    mRNA    linear   INV 22-NOV-2023
DEFINITION  Caenorhabditis elegans Argonaute (plant)-Like Gene (alg-3), mRNA.
ACCESSION   NM_069816
VERSION     NM_069816.3
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 3268)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 3268)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (22-NOV-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3268)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (29-OCT-2023) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 3268)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003282).
            
            On Apr 15, 2020 this sequence version replaced NM_069816.2.
FEATURES             Location/Qualifiers
     source          1..3268
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="IV"
     gene            1..3268
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /db_xref="GeneID:178106"
                     /db_xref="WormBase:WBGene00011910"
     CDS             71..3178
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /standard_name="T22B3.2b"
                     /note="Product from WormBase gene class alg;
                     Confirmed by transcript evidence"
                     /codon_start=1
                     /product="Argonaute (plant)-Like Gene"
                     /protein_id="NP_502217.1"
                     /db_xref="EnsemblGenomes-Gn:WBGene00011910"
                     /db_xref="EnsemblGenomes-Tr:T22B3.2b"
                     /db_xref="GeneID:178106"
                     /db_xref="GOA:G5ED77"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR012337"
                     /db_xref="InterPro:IPR014811"
                     /db_xref="InterPro:IPR032472"
                     /db_xref="InterPro:IPR032473"
                     /db_xref="InterPro:IPR032474"
                     /db_xref="InterPro:IPR036085"
                     /db_xref="InterPro:IPR036397"
                     /db_xref="UniProtKB/TrEMBL:G5ED77"
                     /db_xref="WormBase:WBGene00011910"
                     /translation="
MSRRNATNFVDNNTLTSSGISGSGSLSPPITSRPASGQASPLSSNGSLSPPVDDQGSVSYNSDSPRDLSPLLLSELACLNMREVVARPGLGTIGRKIPVKSNFFAVDLKNPKMVVVQYHVEVHHPGCRKLDKDEMRIIFWKAVSDHPNIFHNKFALAYDGAHQLYTVARLEFPDDQGSVRLDCEATLPKDNRDRTRCAISIQNVGPVLLEMQRTRTNNLDERVLTPIQILDIICRQSLTCPLLKNSANFYTWKSSCYRIPTAAGQALDLEGGKEMWTGFFSSAHIASNYRPLLNIDVAHTAFYKTRITVLQFMCDVLNERTSKPNRNNPRGPGAPGGYRGGRGGARGGSYQNFGNRGPPGANVRDDFGGNGLTFTMDTLSRDTQLSSFETRIFGDSIRGMKIRATHRPNAIRVYKVNSLQLPADKLMFQGIDEEGRQVVCSVADYFSEKYGPLKYPKLPCLHVGPPTRNIFLPMEHCLIDSPQKYNKKMTEKQTSAIIKAAAVDATQREDRIKQLAAQASFGTDPFLKEFGVAVSSQMIETSARVIQPPPIMFGGNNRSINPVVFPKDGSWSMDHQTLYMPATCRSYSMIALVDPRDQTSLQTFCQSLTMKATAMGMNFPRWPDLVKYGRSKEDVCTLFTEIADEYRVTNTVCDCIIVVLQSKNSDIYMTVKEQSDIVHGIMSQCVLMKNVSRPTPATCANIILKLNMKMGGINSRIVADQITNKYLVDQPTMVVGIDVTHPTQAEMRMNMPSVAAIVANVDLLPQSYGANVKVQKKCRESVVYLLDAIRERIITFYRHTKQKPARIIVYRDGVSEGQFSEVLREEIQSIRTACLAIAEDFRPPITYIVVQKRHHARIFCKFPNDMVGKAKNVPPGTTVDTGIVSPEGFDFYLCSHYGVQGTSRPARYHVLLDECKFTADEIQNITYGMCHTYGRCTRSVSIPTPVYYADLVATRARCHIKRKLGLADNNDCDTNSLSSSLASLLNVRTGSGKGKKSHAPSVDDESYSLPDAASDQILQDCVSVAADFKSRMYFI"
     misc_feature    848..982
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    1175..1507
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1310..1312,1352..1354,1394..1396,1406..1408,
                     1457..1459,1478..1480,1484..1486)
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1643..2950
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2072..2074,2084..2086,2120..2131,2138..2140,
                     2162..2164,2171..2173,2183..2185,2195..2197)
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2282..2284,2288..2290,2504..2506,2918..2920)
                     /gene="alg-3"
                     /locus_tag="CELE_T22B3.2"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
aattcagtttgtgatttttcttttccggaaaacgctctacaaaagtacgagctctcttaaagaatctgaaatgtcaagaaggaatgcgacaaattttgtggataacaacacgctgactagttcagggatctcaggatctggttcactgtcaccaccaataacatctcgtccagcgtcaggacaagcgtcaccactctcatccaatggatctttatcacctcctgtcgatgatcaaggttctgtgtcttacaattctgactcgccacgtgacttgagccctcttcttttatcggaattggcctgtctcaacatgcgcgaggtggttgccagaccaggacttggaactatcggacgaaagattccagtgaaatctaacttctttgccgtcgacctgaagaatccgaaaatggttgtagttcagtatcacgttgaagttcatcatccaggatgtagaaaattggacaaagacgaaatgcgtatcattttttggaaagctgtgtcagatcatcctaacatcttccacaataagtttgcattggcatatgatggagctcaccagctatatactgtcgctcgtctcgaattcccggatgatcaaggatctgttcgtcttgactgtgaagctactcttccgaaggataaccgtgatcgtactcgatgtgcaatttcgattcagaatgttgggcctgttttgcttgagatgcaacgtactcgtaccaataatttggatgagcgtgtcctcactccgatccagattttggatattatttgccgccaatcattgacctgtccacttctcaagaattctgccaatttctacacctggaaatcgtcttgctaccgtattccaacggctgccggacaagctcttgatttggaaggaggaaaagaaatgtggactggtttcttctcaagtgcccacattgcgagcaactaccgtcctcttctgaacattgatgtggcacatacggcattctacaagacacgtattactgttcttcagtttatgtgtgacgttttgaatgaaagaacatcaaagccgaatcgcaacaatccacgtggaccgggagcaccgggaggatatcgtggtggacgaggtggtgcaagaggaggcagctaccagaactttggtaatcgtggaccgcctggagctaacgttcgtgacgactttggtggaaatggtcttactttcacaatggatacgttgagccgtgatacccaattgtcgagctttgagactcgtatctttggagattcgattcgtggaatgaagattcgtgccactcatcgcccaaatgcaattcgtgtctacaaagtgaacagtcttcaattgccagctgacaagttgatgttccaaggaatcgatgaggaaggacgacaagttgtgtgctcggttgctgactacttctccgagaagtacggaccactcaagtatccaaaacttccatgtctccatgtcggaccacccactcgtaacatcttcctgccaatggaacattgtttgattgattctcctcaaaagtacaacaaaaagatgactgaaaaacagaccagtgccatcatcaaggctgcagctgttgacgctactcaacgggaagatcggatcaagcaattggctgctcaagcatcgtttggtactgatcctttcctcaaagaattcggagtagcagtctcttctcaaatgattgaaacaagtgctcgtgtcatccagccaccaccaatcatgttcggaggaaataatcgttcaattaatccagtggtgttcccgaaggacggatcatggtctatggatcatcagacactttacatgcctgccacttgtcgcagttactcaatgattgctcttgtggatccacgtgatcagacatcgctccagacattctgccaatctttaacaatgaaggctaccgcaatgggaatgaatttcccgcgttggccggatctggtgaagtacggtagatcaaaggaagatgtttgcactctcttcactgagattgctgatgaatatcgtgtgactaatacagtttgtgattgcatcattgtagttctccagtccaaaaactcggacatctacatgactgtgaaggaacaatctgacattgttcacggaattatgtcccaatgcgtgctcatgaagaatgtgagccgtccaactccagcgacttgtgccaacattattctcaagctcaacatgaaaatgggaggaatcaatagtcgtattgttgctgatcaaatcactaacaaatatcttgttgatcaaccgaccatggttgttggaattgacgttactcatccaactcaagctgaaatgcgtatgaatatgccatcagttgcagctatcgttgcaaacgttgacttgcttccacaatcgtatggtgcaaatgtgaaggtgcagaagaaatgtcgtgaatcggttgtctacttgctggatgcaattcgtgagagaatcattactttctacagacataccaagcaaaagccagctcgtatcattgtctatcgtgatggagtgtctgaaggacaattctctgaagttctccgcgaagagattcaatcaatccgtacggcttgcctggcaattgctgaagacttccgtccaccaataacctacatcgttgttcaaaaaagacatcatgctcgcatcttctgcaagttcccgaacgacatggttggaaaggcaaagaatgttccacctggtaccactgtcgacactggaatcgtctctcccgaaggatttgatttctacctatgctctcactatggagtacagggaacttctcgccctgcgagatatcacgttcttctggatgaatgcaagttcactgctgatgaaattcaaaacatcacttatggaatgtgccatacatatggtcgttgtactcgttcggtctccatcccaactccagtttactatgctgatttggttgctactcgtgcccgctgtcacatcaagagaaagctcggtcttgccgacaacaatgactgtgacaccaactcgctctcttcatcacttgcttctttgctcaacgtgagaactggaagtggaaaaggaaagaagtcacatgctccaagcgtcgatgatgaatcgtattctcttcctgacgctgcatctgatcaaatccttcaggactgcgtctcggttgcagctgactttaagagtcgtatgtacttcatttgaagactcttcatgcagacggagccagagaaaattgttcatttctttaaacttgatgtcctttttgtatcgccaaaataaagtttcggacat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]