2024-05-18 15:24:57, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001025813 20769 bp mRNA linear INV 22-NOV-2023 DEFINITION Caenorhabditis elegans Muscle M-line assembly protein unc-89 (unc-89), mRNA. ACCESSION NM_001025813 VERSION NM_001025813.2 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 20769) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 20769) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-NOV-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 20769) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (29-OCT-2023) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 20769) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003279). On Sep 4, 2019 this sequence version replaced NM_001025813.1. FEATURES Location/Qualifiers source 1..20769 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="I" gene 1..20769 /gene="unc-89" /locus_tag="CELE_C09D1.1" /db_xref="GeneID:171990" /db_xref="WormBase:WBGene00006820" CDS 192..20090 /gene="unc-89" /locus_tag="CELE_C09D1.1" /standard_name="C09D1.1a" /note="Confirmed by transcript evidence" /codon_start=1 /product="Muscle M-line assembly protein unc-89" /protein_id="NP_001020984.1" /db_xref="GeneID:171990" /db_xref="WormBase:WBGene00006820" /translation="
MASRRQKQFDRKYSSYRKFTATEDVNYSTHSSRSSYRSESLTSRTDGRGRSTSSEIIAGSESRSYPVYIAIQDYTPDKEDVEAIPLEQGQIVEVLDKKNSVRWLVRTKARPPRSGWVPGSYFETPTEFYKQRRRTREIENVSLSDEQAALVKRDQVYHELLRSEEEFVSSLRTCVDDYIKVLDDPEVPEAVKKNREELTLNIPELYNFHANVMLKGLNYYSDDPGKVGQTFVRLEKDFESHVEFYKQYADTLKLLEEPEIKRFFEGLSAKNDAGASSFVDHVKEIADRMVQYQNYFKEFVKYSARAHGSSKSIQKALELVTTIPQRVHDLEFTNNLKQHPGDTGKLGRIIRHDAFQVWEGDEPPKLRYVFLFRNKIMFTEQDASTSPPSYTHYSSIRLDKYNIRQHTTDEDTIVLQPQEPGLPSFRIKPKDFETSEYVRKAWLRDIAEEQEKYAAERDAISMTATSEMTASSVDFDMNASDQQSEFSEWSGSRKSSLFPGPEEGGPPRKKVKSPPVISPTGSSTSIYSGGSSSIDWTTTGTTLEMQGTRVTRTQYGFRTLQESSAKMCLKVTGYPLPDITWYKDDVQLHEDERHTFYSDEDGFFAMTIDPVQVTDTGRYTCMATNEYGQASTSAFFRVLKVEKEAAPPAFVTKLRDKECKEGDVIDFECEVEGWPEPELVWLVDDQPLRPSHDFRLQYDGQTAKLEIRDAQPDDTGVYTVKIQNEFGSIESKAELFVQADPDKNHVAPEFQATIEYVECDEGEEVRFKSVITGDPNPEIIWFINGKPLSESEKVKFISEDGICILTIKDVTRHFDGMVTCQGSNRLGSASCDGRLKVRVPPAPPTFNKPLEDKTVQEKSTVVFEVDVSGWPEPTLTFTLCGKELKNGEEGVEIVGHDGFYRISIPNTSMDKHDGEIVAKAQNEHGTAESRARLTVEQEEEESRSAPTFLKDIEDQTVKTGEFAVFETTVRGNPNPEVTWFINGHKMDQGSPGVKIEAHNHDHKLTIDSAQYAGTVLCRAENAVGRFETKARLVVLAPEKQKKPPKFVEILVDKTETVDNTVVFEVRVEGEPKPTVTWYLKGEELKQSDRVEIREFDGSIKISIKNIKIEDAGEIRAVATNSEGSDETKAKLTVQKKPFAPEFDLRPVSLTVEKGSEAVFSAHAFGIPLPTYEWSVNGRKVRDGQEGARVTRDESTVDGASILTIDTATYYSEVNHLTISVVAENTLGAEETGAQLTIEPKKESVVVEKQDLSSSEVQKEIAQQVKEASPEATTTITMETSLTSTKTTTMSTTEVTSTVGGVTVETKESESESATTVIGGGSGGVTEGSISVSKIEVVSKTDSQTDVREGTPKRRVSFAEEELPKEVIDSDRKKKKSPSPDKKEKSPEKTEEKPASPTKKTGEEVKSPKEKSPASPTKKEKSPAAEEVKSPTKKEKSPSSPTKKEKSPSSPTKKTGDEVKEKSPPKSPTKKEKSPEKPEDVKSPVKKEKSPDATNIVEVSSETTIEKTETTMTTEMTHESEESRTSVKKEKTPEKVDEKPKSPTKKDKSPEKSITEEIKSPVKKEKSPEKVEEKPASPTKKEKSPEKPASPTKKSENEVKSPTKKEKSPEKSVVEELKSPKEKSPEKADDKPKSPTKKEKSPEKSATEDVKSPTKKEKSPEKVEEKPTSPTKKESSPTKKTDDEVKSPTKKEKSPQTVEEKPASPTKKEKSPEKSVVEEVKSPKEKSPEKAEEKPKSPTKKEKSPEKSAAEEVKSPTKKEKSPEKSAEEKPKSPTKKESSPVKMADDEVKSPTKKEKSPEKVEEKPASPTKKEKTPEKSAAEELKSPTKKEKSPSSPTKKTGDESKEKSPEKPEEKPKSPTPKKSPPGSPKKKKSKSPEAEKPPAPKLTRDLKLQTVNKTDLAHFEVVVEHATECKWFLDGKEITTAQGVTVSKDDQFEFRCSIDTTMFGSGTVSVVASNAAGSVETKTELKVLETPKETKKPEFTDKLRDMEVTKGDTVQMDVIALHSPLYKWYQNGNLLEDGKNGVTIKNEENKSSLIIPNAQDSGKITVEASNEVGSSESSAQLTVNPPSTTPIVVDGPKSVTIKETETAEFKATISGFPAPTVKWTINEKIVEESRTITTIKTEDVYTLKISNAKIEQTGTVKVTAQNSAGQDSKQADLKVEPNVKAPKFKSQLTDKVADEGEPLRWNLELDGPSPGTEVSWLLNGQPLTKSDTVQVVDHGDGTYHVTIAEAKPEMSGTLTAKAKNAAGECETSAKVTVNGGNKKPEFVQAPQNHETTLEESVKFSAIVTGKPMPNVTWYLNNKKLIQSEEVKVKYVHETGKTSIRIQKPLMEHNGTIRVEAENVSGKVQATAQLKVDKKTEVPKFTTNMDDRQVKEGEDVKFTANVEGYPEPSVAWTLNGEPVSKHPNITVTDKDGEHTIEISAVTPEQAGELSCEATNPVGSKKRDVQLAVKKVGDAPTFAKNLEDRLITEGELTLMDAKLNIVKPKPKITWLKDGVEITSDGHYKIVEEEDGSLKLSILQTKLEDKGRITIKAESEFGVAECSASLGVVKGRPMAKPAFQSDIAPINLTEGDTLECKLLITGDPTPFVKWYIGTQLVCATEDTEISNANGVYTMKIHGVTADMTGKIKCVAYNKAGEVSTEGPLKVVAPIPVEFETSLCDATCREGDTLKLRAVLLGEPEPVVSWYVNGKKLEESQNIKIHSEKGTYTVTIKDITCDYSGQVVCEAINEYGKATSEATLLVLPRGEPPDFLEWLSNVRARTGTKVVHKVVFTGDPKPSLTWYINNKEILNSDLYTIVTDDKTSTLTINSFNPDVHVGEIICKAENDAGEVSCTANMITYTSDMFSESESEAQAEEFVGDDLTEDESLREEMHRTPTPVMAPKFITKIKDTKAKKGHSAVFECVVPDTKGVCCKWLKDGKEIELIARIRVQTRTGPEGHITQELVLDNVTPEDAGKYTCIVENTAGKDTCEATLTVIESLEKKSEKKAPEFIVALQDKTTKTSEKVVLECKVIGEPKPKVSWLHDNKTITQESITVESVEGVERVTITSSELSHQGKYTCIAENTEGTSKTEAFLTVQGEAPVFTKELQNKELSIGEKLVLSCSVKGSPQPHVDFYSFSETTKVETKITSSSRIAIEHDQTNTHWRMVISQITKEDIVSYKAIATNSIGTATSTSKITTKVEAPVFEQGLKKTSVKEKEEIKMEVKVGGSAPDVEWFKDDKPVSEDGNHEMKKNPETGVFTLVVKQAATTDAGKYTAKASNPAGTAESSAEAEVTQSLEKPTFVRELVTTEVKINETATLSVTVKGVPDPSVEWLKDGQPVQTDSSHVIAKVEGSGSYSITIKDARLEDSGKYACRATNPAGEAKTEANFAVVKNLVPPEFVEKLSPLEVKEKESTTLSVKVVGTPEPSVEWFKDDTPISIDNVHVIQKQTAVGSFSLTINDARQGDVGIYSCRARNEAGEALTTANFGIIRDSIPPEFTQKLRPLEVREQETLDLKVTVIGTPVPNVEWFKDDKPINIDNSHIFAKDEGSGHHTLTIKQARGEDVGVYTCKATNEAGEAKTTANMAVQEEIEAPLFVQGLKPYEVEQGKPAELVVRVEGKPEPEVKWFKDGVPIAIDNQHVIEKKGENGSHTLVIKDTNNADFGKYTCQATNKAGKDETVGELKIPKYSFEKQTAEEVKPLFIEPLKETFAVEGDTVVLECKVNKESHPQIKFFKNDQPVEIGQHMQLEVLEDGNIKLTIQNAKKEDVGAYRCEAVNVAGKANTNADLKIQFAAKVEEHVTDESGQLEEIGQFETVGDTASSKTDTGRGAPEFVELLRSCTVTEKQQAILKCKVKGEPRPKIKWTKEGKEVEMSARVRAEHKDDGTLTLTFDNVTQADAGEYRCEAENEYGSAWTEGPIIVTLEGAPKIDGEAPDFLQPVKPAVVTVGETAVLEGKISGKPKPSVKWYKNGEELKPSDRVKIENLDDGTQRLTVTNAKLDDMDEYRCEASNEFGDVWSDVTLTVKEPAQVAPGFFKELSAIQVKETETAKFECKVSGTKPDVKWFKDGTPLKEDKRVHFESTDDGTQRLVIEDSKTDDQGNYRIEVSNDAGVANSKVPLTVVPSETLKIKKGLTDVNVTQGTKILLSVEVEGKPKTVKWYKGTETVTSSQTTKIVQVTESEYKLEIESAEMSDTGAYRVVLSTDSFSVESSATVTVTKAAEKISLPSFKKGLADQSVPKGTPLVLEVEIEGKPKDVKWYKNGDEIKDGKVEDLGNGKYRLTIPDFQEKDVGEYSVTAANEAGEIESKAKVNVSAKPEIVSGLVPTTVKQGETATFNVKVKGPVKGVKWYKNGKEIPDAKTKDNGDGSYSLEIPNAQVEDAADYKVVVSNDAGDADSSAALTVKLADDGKDKVKPEIVSGLIPTTVKQGETATFNVKVKGPVKQVKWYKNGKEIPNAKAKDNGDGSYSLEIPNAQLDDTADYKVVVSNDAGDADSSAALTVKLPGIAIVKGLEDAEVPKGKKAVLQVETNKKPKEIKWYKNGKEITPSDKAQPGSDGDNKPQLVIPDAGDDDAAEYKVVLTDEDGNTADSSCALTVKLPAKEPKIIKGLEDQVVSIGSPIKLEIETSGSPKTVKWYKNGKELPGAAAKTIKIQKIDDNKYVLEIPSSVVEDTGDYKVEVANEAGSANSSGKITVEPKITFLKPLKDQSITEGENAEFSVETNTKPRIVKWYKNGQEIKPNSRFIIEQKTDTKYQLVIKNAVRDDADTYKIVLENTAGEAESSAQLTVKKAKAGLCKIVKGLEDQVVAKGAKMVFEVKIQGEPEDVRWLRDANVISAGANAIIEKIDDTTYRLIIPSADLKDAGEYTVEVINESGKAKSDAKGEVDEKPEIVRGLENIEIPEGDDDVFKVEVSAPVRQVKWYKNDQEIKPNSHLEAKKIGPKKYELAINRAQLDDGADYKVVLSNAAGDCDSSAALTVVKPNVLKIVDGLKDVDVEEPQPVELKVKVEGIPKVIKWYKNGQELKPDADGFKFEEKPESGEFSLTIPSSKKSDGGAYRVVLGNDKGEVYSGSVVHVKSAKSSEPTSGANFLSPLKDTEVEEGDMLTLQCTIAGEPFPEVIWEKDGVVLQKDDRITMRVALDGTATLRIRSAKKSDIGQYRVTAKNEAGSATSDCKVTVTEQGEQPSKPKFVIPLKTGAALPGDKKEFNVKVRGLPKPTLQWFLNGIPIKFDDRITLDDMADGNYCLTIRDVREEDFGTLKCIAKNENGTDETVCEFQQGAGHDDGSRDDLRYPPRFNVPLWDRRIPVGDPMFIECHVDANPTAEVEWFKDGKKIEHTAHTEIRNTVDGACRIKIIPFEESDIGVYMCVAVNELGQAETQATYQVEILEHVEEEKRREYAPKINPPLEDKTVNGGQPIRLSCKVDAIPRASVVWYKDGLPLRADSRTSIQYEEDGTATLAINDSTEEDIGAYRCVATNAHGTINTSCSVNVKVPKQEVKKEGEEPFFTKGLVDLWADRGDSFTLKCAVTGDPFPEIKWYRNGQLLRNGPRTVIETSPDGSCSLTVNESTMSDEGIYRCEAENAHGKAKTQATAHVQMALGKTEKPKMDEGKPPKFILELSDMSVSLGNVIDLECKVTGLPNPSVKWSKDGGPLIEDSRFEWSNEASKGVYQLRIKNATVHDEGTYRCVATNENGSATTKSFVRMDDGLGSGVVTASQPPRFTLKMGDVRTTEGQPLKLECKVDASPLPEMVWYKDGAIVTPSDRIQISLSPDGVATLLIPSCVYDDDGIYRVIATNPSGTAQDKGTATVKKLPRDSGARRSADRDVFDANKAPKLMEPLENIRIPEKQSFRLRCKFSGDPKPTIKWFKDGERVFPYGRLQLIESPDGVCELVVDSATRQDAGGYRCVAENTYGSARTSCDVNVIRGDRKPRDIDSSIREGKAPGFTTPLTIRRAKPGDSVTFECLPFGNPFPSIKWLKDGLELFSDEKIKMEAAADGTQRLILSDVTFLSEGYFRCVATNEHGTASTKAELVIEGDRTIGSRPLPEVNGEPEECKPRIRRGLYNMSIHEGNVVEMIVCATGIPTPTVKWYKDGQEIVGDGPDGKRVIFTDERGIHHLVIVNASPDDEGEYSLEATNKLGSAKTEGSLNIIRPRHIADADERGGMPFPPGFVRQLKNKHVFNHMPTIFDCLVVGHPAPEVEWFHNGKKIVPGGRIKIQSCGGGSHALIILDTTLEDAGEYVATAKNSHGSASSSAVLDVTVPFLDSIKFNGEIDVTPYLTEEYGFKKLNTASLPTPPDRGPFIKEVTGHYLTLSWIPTKRAPPRYPQVTYVIEIRELPEKQWSLLEYNIPEPVCKVRNLELGKSYQFRVRAENIYGISDPSPASPPSRLMAPPQPVFDRRTNKVIPLLDPYAEKALDMRYSEQYACAPWFSPGVVEKRYCAENDTLTIVLNVSGFPDPDIKWKFRGWDIDTSSPTSKCKVYTYGGSETTLAITGFSKENVGQYQCFAKNDYGDAQQNIMVDLATRPNFIQPLVNKTFSSAQPMRMDVRVDGEPFPELKWMKEWRPIVESSRIKFVQDGPYLCSLIINDPMWRDSGIYSCVAVNDAGQATTSCTVTVEAEGDYNDVELPRRRVTIESRRVRELYEISEKDEK"
misc_feature 384..563 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Src Homology 3 domain superfamily; Region: SH3; cl17036" /db_xref="CDD:450141" misc_feature order(405..407,411..413,420..422,438..440,492..497, 543..545,549..554) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="peptide ligand binding site [polypeptide binding]; other site" /db_xref="CDD:212690" misc_feature 648..1175 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous (DH) domain. It appears that PH domains invariably occur C-terminal to RhoGEF/DH domains; Region: RhoGEF; cd00160" /db_xref="CDD:238091" misc_feature order(666..668,678..680,957..959,1026..1031,1038..1043, 1047..1052,1059..1064,1071..1076,1083..1085,1161..1163, 1173..1175) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:238091" misc_feature 1212..1556 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="unc89 pleckstrin homology (PH) domain; Region: PH_unc89; cd13325" /db_xref="CDD:270134" misc_feature 1884..1898 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature <1899..2105 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1923..1937 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2001..2015 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2043..2060 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2082..2093 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2133..2402 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 2184..2198 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2223..2237 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2298..2312 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2340..2357 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2379..2390 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2433..2702 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 2484..2498 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2523..2537 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2598..2612 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2640..2657 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2679..2690 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2721..2996 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2772..2786 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2811..2825 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2889..2903 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2934..2951 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2973..2984 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3027..3293 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 3078..3092 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3117..3131 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3195..3209 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3219..3248 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3270..3281 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3321..3590 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 3372..3386 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3411..3425 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3486..3500 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3528..3545 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3567..3578 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3609..3902 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 3660..3674 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3699..3713 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3789..3803 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3813..3857 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3879..3890 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature <4101..6167 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="MAEBL; Provisional; Region: PTZ00121" /db_xref="CDD:173412" misc_feature 6135..6395 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6186..6200 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6219..6233 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6297..6311 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6333..6350 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6372..6383 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6432..6683 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6465..6479 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6504..6518 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6579..6593 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6621..6638 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6660..6671 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6702..6977 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6753..6767 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6795..6809 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6867..6887 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6915..6932 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6954..6965 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6996..7271 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 7047..7061 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7086..7100 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7167..7181 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7209..7226 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7248..7259 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7290..7559 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7341..7355 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7380..7394 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7455..7469 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7497..7514 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7536..7547 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7578..7853 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 7629..7643 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7671..7685 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7749..7763 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7791..7808 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7830..7841 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7878..8147 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 7968..7982 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8043..8057 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8085..8102 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8124..8135 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8166..8432 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8214..8228 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8253..8267 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8328..8342 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8370..8387 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8409..8420 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8451..8720 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 8541..8555 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8616..8630 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8661..8678 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8700..8711 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8850..9134 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8901..8915 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8940..8954 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9030..9044 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9072..9089 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9111..9122 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9171..9437 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9222..9236 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9261..9275 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9327..9347 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9375..9392 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9414..9425 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9450..9740 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 9501..9515 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9540..9554 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9636..9653 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9681..9698 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9756..10028 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9807..9821 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9843..9857 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9924..9938 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9966..9983 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10005..10016 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10047..10322 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10098..10112 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10137..10151 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10218..10232 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10260..10277 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10299..10310 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10341..10607 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10392..10406 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10431..10445 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10512..10526 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10554..10571 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10593..10604 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10635..10910 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10686..10700 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10725..10739 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10806..10820 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10848..10865 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10887..10898 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10929..11204 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10980..10994 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11019..11033 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11100..11114 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11142..11159 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11181..11192 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11247..11519 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11298..11312 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11337..11351 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11415..11429 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11457..11474 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11496..11507 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11640..11897 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11691..11705 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11730..11744 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11808..11822 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11850..11867 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11889..11900 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11949..12221 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12000..12014 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12039..12053 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12111..12131 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12159..12176 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12198..12209 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12243..12512 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12294..12308 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12330..12344 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12408..12422 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12450..12467 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12489..12500 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12531..12797 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12579..12593 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12615..12629 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12735..12752 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12774..12785 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12825..13085 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12876..12890 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12912..12926 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12981..12995 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13023..13040 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13062..13073 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13095..13355 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13146..13160 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13182..13196 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13251..13265 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13293..13310 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13332..13343 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13389..13649 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13440..13454 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13476..13490 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13545..13559 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13587..13604 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13626..13637 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13668..13937 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 13713..13727 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13749..13763 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13827..13841 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13869..13886 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13911..13922 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13953..14228 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 14004..14018 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14040..14054 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14124..14138 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14166..14183 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14205..14216 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14244..14507 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14289..14303 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14325..14339 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14403..14417 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14445..14462 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14484..14495 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14532..14798 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 14580..14594 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14619..14630 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14694..14708 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14736..14753 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14775..14786 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14808..15077 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 14859..14873 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14895..14909 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14973..14987 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15015..15032 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15054..15065 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15126..15371 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 15144..15158 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15180..15194 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15264..15278 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15306..15323 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15345..15356 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15408..15674 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15453..15467 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15492..15506 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15570..15584 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15612..15629 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15651..15662 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15702..15971 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15753..15767 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15792..15806 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15870..15884 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15912..15929 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15957..15968 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16020..16292 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 16071..16085 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16110..16124 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16188..16202 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16230..16247 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16269..16280 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16338..16610 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16389..16403 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16428..16442 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16506..16520 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16548..16565 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16587..16598 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16650..16922 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16701..16715 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16740..16754 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16818..16832 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16860..16877 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16902..16913 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16974..17243 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 17064..17078 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17139..17159 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 17187..17204 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17229..17240 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 17292..17564 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 17343..17357 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 17382..17396 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17460..17474 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 17502..17519 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17634..17906 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 17685..17699 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 17724..17738 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17802..17816 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 17844..17861 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17883..17894 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 17964..18236 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 18015..18029 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 18054..18068 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 18132..18146 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 18174..18191 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 18213..18224 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 18303..18584 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 18354..18368 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 18393..18407 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 18480..18494 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 18522..18539 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 18561..18572 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 18639..18911 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 18690..18704 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 18729..18743 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 18807..18821 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 18849..18866 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 18888..18899 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 19014..19265 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature order(19014..19016,19215..19217,19260..19262) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature <19488..19676 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 19509..19523 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 19596..19610 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 19638..19655 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 19719..19982 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 19761..19775 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 19800..19814 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 19878..19892 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 19920..19937 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 19959..19970 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" ORIGIN
agagcagtcggctcaagaaaagagaggaatccgggtgccaacatcattattgggccatttttgtctgcgtgtgtgatctaatttgatcaatctcttactcccatcagccagcttgaacattaaaaaacaagttgaccttctcctcgatagtgccctcataaggcgcttaaacccaccttacccttaccatcatggctagtcgacgccaaaagcagttcgatcggaagtacagctcctatcgaaaattcactgcaaccgaagatgtcaactacagtacccactcgtcaagatcatcctatcgatctgaatcattgacttcgagaaccgatggacgcgggcggtccacgtcatccgaaatcattgccggatcggaatcccgatcttatccagtgtacattgcgattcaagactacactcctgacaaagaagacgtggaagcgattcccttagaacaaggtcaaattgtcgaggtgctcgacaagaagaactcggttcgatggcttgttagaacaaaggcacgtccaccacgttccggttgggttccgggatcgtactttgaaactccgaccgagttttacaagcaaagaagacgaacgagagaaattgagaacgtcagtctgtctgatgaacaggcggctcttgtcaagagagaccaagtctaccatgagctgctccgttccgaagaggaattcgtctcatctcttcgaacttgcgtcgatgattacatcaaagttctcgatgatcccgaagtaccagaagccgtcaaaaagaaccgcgaagagcttactctcaacattccagagctctataatttccacgccaatgtgatgctgaaaggcctcaactattattctgacgatccgggcaaggtcggtcagacttttgtccgtcttgaaaaagactttgagagccacgtggagttctataagcagtacgcagatacactgaaattgcttgaagaacctgaaattaagagattctttgagggtctctccgcaaaaaatgacgctggagcatcctcattcgtcgaccatgtcaaagagatcgccgatcgaatggtccaatatcaaaattattttaaagagtttgtcaagtattctgcaagagcacacggttcatcaaaaagtattcaaaaggcgctggaattggtcaccactattccgcaaagagttcacgatctagaattcaccaataatttgaagcaacatccaggagatactggaaagttgggacggattatcagacatgacgctttccaagtgtgggaaggagatgagccaccgaaacttcgctacgtgttcctgttccgaaataaaataatgttcacggaacaagatgcatcgacaagtccaccaagttatacacattattcatcaattcgattggacaaatacaatatcagacaacacacgacagacgaggatactattgtccttcaacctcaggaaccgggacttccaagtttcagaatcaaaccaaaggactttgaaacttcggagtacgtgcgcaaagcctggctgagggacatcgcagaggagcaggagaaatatgctgctgaacgagatgcgatctcgatgacggcaacgtcagagatgaccgcatcctcggtcgatttcgatatgaacgcgtcggaccagcaatccgaattttcggaatggtccggctcccgaaagagcagcttgttccctggtccagaagaaggaggtccaccacgaaagaaggtaaaatcaccgccggtgatttcacctaccggctcgtccaccagtatctattcaggaggaagtagtagtattgattggacaacaactggaacgacactcgaaatgcaaggaacgcgtgtaaccagaacccaatacggtttcagaaccttgcaagaatcatcagcgaaaatgtgtctgaaagtaactggatatccattacctgatatcacatggtacaaagatgatgtacaacttcatgaagatgagagacacactttttattcggatgaagatggtttctttgcgatgaccattgatccagttcaggtgaccgacactggtcgttacacatgtatggcaacaaacgaatacggtcaggcatccacttctgcctttttccgagttttgaaagtcgaaaaagaagctgctccaccagcatttgtcacaaaactcagagacaaagaatgcaaagaaggtgatgttattgatttcgaatgtgaagttgaaggatggcctgaaccggaacttgtatggcttgtcgacgatcagccactccgaccatcccacgactttcggctgcaatatgatggacagacggcaaagctcgaaattcgtgatgctcagccggatgatactggagtctatacagtcaagattcaaaatgagttcggatcgattgaaagcaaggctgagctctttgttcaagcagatccagataagaaccatgtggctccagagttccaggcaacaattgaatatgttgagtgtgatgagggagaggaagttcgattcaagtcagttattactggagatcctaatccagaaatcatttggttcatcaatggaaaaccactgagtgaatcagaaaaagtcaagttcatctcggaagatggaatctgcatcttaacgattaaagacgtaaccaggcatttcgatggaatggttacatgtcaaggatcaaacagattgggttcagcgtcttgtgatggaaggctaaaagtcagagttccaccagcaccaccaacctttaataagccactcgaagataagacagtccaggagaagagtactgttgtgttcgaagtggatgtcagcggatggccagagccaacactaaccttcacactttgcggaaaagagttgaaaaacggtgaagaaggcgttgaaatcgtagggcacgacggtttctatcgcatttcgatcccgaacacatcgatggacaagcacgacggtgaaattgtggcaaaggctcaaaatgagcatggaaccgcggagagtagggcacggctcactgtggaacaggaggaggaggagtcgcgcagtgcgccgactttcttgaaggatattgaagatcaaaccgtaaaaaccggcgagttcgccgtcttcgagacaaccgttcgcggaaatccgaatccggaggttacttggttcatcaacgggcacaagatggatcagggcagtccgggcgtcaagatcgaggcgcacaatcacgaccataagctgactatcgactcggcacagtacgcgggcaccgtactctgcagagctgaaaatgctgttggacgattcgaaacgaaagcccgactcgttgttctggccccagaaaaacagaagaaaccaccgaaattcgtggagattcttgtcgacaaaaccgaaaccgtcgacaacacagttgtgtttgaagttcgcgttgaaggtgaaccaaaaccgactgtaacatggtatttaaaaggagaagaactcaaacaatcggatcgcgtcgagattcgagaattcgatggatcaataaaaatctcaatcaagaacatcaaaattgaagatgccggagagatcagggctgttgcgacaaactctgaaggatctgatgagacgaaggcgaaattgactgttcagaagaagccattcgctccagaatttgatttgcgaccagttagcttgacagtcgaaaagggatccgaagcagttttcagtgcacacgcttttggtattccattgccaacttatgaatggtctgtcaatggaagaaaggtgcgagatggacaggaaggggcgcgcgtaacacgtgacgagagcaccgtcgacggcgcatcgatcctgacgatcgacacggcgacatactattccgaagtgaaccatctgacaatttctgttgtcgcagaaaacacactcggagccgaagagacgggcgcccagttgacgatcgagccgaagaaggagagtgtcgtcgtcgaaaagcaagatttgtccagttcagaagtccagaaggaaatagctcagcaggtaaaagaagcttctcctgaggcaacaacaaccatcacaatggagacatcgttgacgtcaactaaaacaactacaatgtccacaactgaagtcacatcaacagttggaggagtgactgtcgagaccaaggagtcggaatcggaatccgcgacaacagtgatcggaggaggatcaggtggtgtaaccgagggaagcatcagtgttagcaagattgaggttgtctcgaagacggactcacagactgatgttagagaaggaacaccaaagagacgagtgtcgtttgctgaagaggaattgccaaaagaggttattgattcggaccgcaaaaagaagaagagtccaagcccggacaaaaaggagaagagccctgagaaaactgaggaaaagcctgctagtcctactaagaagactggtgaggaggtgaagtctccaaaggagaagagcccagcaagtccgacaaagaaggaaaagtcacctgcagcagaggaagttaaatcacctaccaaaaaggagaaatctccatcatcaccaaccaagaaggaaaagagcccatcgtctccaaccaaaaagactggggatgaggtgaaagaaaagtctccaccaaagagcccaaccaaaaaggaaaagagcccggagaaacctgaagatgtaaaatctccagttaagaaggaaaaaagcccggatgcaactaatattgttgaagtttcctctgaaacaacaattgagaaaactgaaactactatgaccactgagatgacacacgaatcggaagagtcaagaacttccgtgaaaaaggagaagactccggagaaggttgatgaaaaaccaaagagcccgacgaagaaggacaaatcaccagaaaagtctattaccgaggagatcaagtcacctgtcaaaaaagagaaatctccggagaaggtggaagagaaaccagctagtcctaccaagaaagagaagtctccagaaaaaccagcttcgccgacaaagaagtcggaaaatgaagtaaaatctccaactaaaaaagagaagagtccagagaaatctgtagttgaagagctaaaatctccaaaggaaaaatcaccagagaaggctgacgacaagccaaagagcccgacaaagaaggagaagtcacctgaaaaatcggctacggaagatgtgaaatctccaaccaaaaaagaaaaatctccagaaaaagttgaagagaagccaacgagcccaaccaaaaaagagtcctcgccaactaaaaagaccgatgatgaggtaaagtctccaaccaagaaggagaagagcccacaaaccgttgaagaaaaaccagctagcccgacaaagaaggagaagtcgccagagaaatctgtagtagaagaggtgaaatctcccaaagaaaaatctccagaaaaggctgaggagaagccaaagagtcctacaaagaaagagaagtcacctgaaaagtccgctgcggaagaagtcaaatctcctaccaaaaaagagaagtctccagaaaagtctgctgaggagaagcctaagagcccaaccaaaaaagagtcttcaccagttaaaatggcagatgatgaggtgaaatctccaaccaagaaggaaaagagccccgaaaaggttgaagaaaaacctgcgagcccaaccaagaaagaaaaaacaccagaaaagtcagctgccgaagaactcaaatctcccacgaagaaggaaaagagcccatcttcaccaaccaagaaaactggggacgaatccaaagaaaaatctccagaaaaaccagaggagaagccaaagagcccgacaccaaagaagtctccaccaggctcaccaaagaagaagaagtcaaagtcgccggaagccgaaaagcctccagcgccaaagctcactcgcgacctcaaattgcagacagtcaacaagaccgacttggcccatttcgaagttgtcgttgaacatgcaaccgagtgcaaatggttcttggatggaaaagagattacgacagcccaaggggttacggtttcaaaggacgatcaatttgaattccgttgctcaattgatacaaccatgtttggaagtggaactgtgtctgttgtggcttcaaatgctgctggttccgtggagactaagactgaattgaaggttttggaaactccaaaggaaaccaagaaaccagaattcactgacaagctcagagatatggaagtcacaaagggagatacagtacagatggacgtcatcgccctacactcgcctctatacaaatggtaccaaaatggaaatctgttggaagatggaaagaatggagttaccattaagaacgaggaaaacaaatcttcattgatcattccaaatgctcaagattctggaaagatcacagttgaagcttcgaacgaagtcggatcatctgaatcctctgctcaactgactgtcaatccaccatcaactaccccaattgttgttgatggaccaaagtcggtgactatcaaggaaacggaaactgctgagttcaaggcaacaattagcggattcccagcaccaactgtcaaatggacgattaatgaaaagatcgtagaggaatctagaactatcaccactatcaagacggaagacgtctatactttgaagatctctaatgcaaagatcgagcagactggaactgtgaaagttactgctcaaaattcagctggacaggatagcaagcaagctgaccttaaggttgaaccaaatgtgaaagctccaaagttcaagtctcagctcactgataaggttgctgatgaaggagaaccactccgttggaatcttgaattggatgggccatcacctggaactgaagtctcttggcttcttaacggacagccacttacaaagagtgatactgttcaagtagtcgatcatggagatggaacttatcatgtgacgattgcagaggccaagccagaaatgtctggaactcttacagcaaaagcaaagaacgccgcaggagagtgtgagacatcggcaaaggttactgtgaatggaggaaacaagaaaccagaatttgttcaagctccacaaaatcacgagacaactcttgaagaaagtgttaagttcagcgctattgttactggaaaaccaatgccaaatgtgacatggtatttgaacaacaagaagttgatccagagtgaggaggttaaagtgaagtatgttcatgagactggaaagacatcaatccgcattcaaaagccactcatggagcacaatggaactatccgcgttgaagctgagaatgtgtcaggaaaggttcaagccacagctcaattgaaggttgacaaaaagactgaagttccaaagttcactacgaacatggatgatcgtcaagtcaaagagggagaagatgtgaagttcactgcaaatgtggaaggataccctgaaccatctgtagcatggactttgaatggagaaccagtttctaagcatccaaacatcactgttaccgacaaggacggagagcacaccatcgaaatttccgccgtcacacccgaacaagctggagagctgtcttgcgaagcgacaaaccccgtcggatccaaaaagagagatgttcaactcgctgttaaaaaggtcggtgatgcaccaacgtttgcaaagaatctcgaagatcggttgatcaccgagggagagttgacattgatggatgctaaattaaacattgtaaaaccaaagccaaagatcacctggcttaaggatggtgttgaaattacttctgatgggcattataagattgttgaagaggaagatggatccttgaaacttagcattcttcaaactaaactggaagataagggaagaatcacgattaaagcggaaagcgaatttggcgttgcggaatgttcagcatctcttggagttgttaagggacgcccaatggccaaaccagcattccaaagtgatattgcaccaattaacctcaccgaaggagatacccttgaatgcaagcttctcatcaccggagacccaacacctttcgtcaagtggtacattggaacacaactcgtttgtgccactgaagatactgagatctctaatgccaatggagtttacactatgaagattcatggtgtgactgctgacatgactggaaagatcaagtgcgtcgcatacaataaggctggagaagtgagcaccgagggtccactcaaggttgttgcaccgattccggttgaatttgaaacatctctatgtgatgctacctgcagagaaggagatactctcaaattgagggcagtattgctcggagagccagaaccagttgtctcgtggtatgtgaacggaaagaagttggaagaatctcagaatatcaagattcattctgagaaaggaacatacacggttacaatcaaagacatcacatgcgattattctggacaagtcgtctgcgaggcaatcaacgagtatggaaaagcaacatctgaggctacattgctcgtgctgccacgtggtgaacctccagatttcttggaatggctcagcaatgttcgcgcaagaactggaaccaaggtcgtgcacaaggttgtcttcacaggagacccgaaaccaagccttacatggtacatcaataataaggagattctcaactcggatctttacaccatcgtcacagatgataaaacatcaacgttgacaatcaacagcttcaacccagatgttcatgttggagaaattatctgcaaggccgagaacgatgctggagaagtttcctgtaccgcaaacatgatcacctacacatctgacatgttcagtgaatctgaaagtgaagcccaagctgaagaatttgtcggagacgatctcactgaagatgagagtcttcgagaggaaatgcaccgtactccaactccagttatggcacccaaattcatcacaaagatcaaggataccaaagccaagaagggacactctgctgtctttgaatgcgttgttccagacaccaagggagtgtgctgcaagtggttgaaggacggaaaagagattgagctgattgccagaatccgggttcaaactagaactggaccagagggacacatcactcaagaacttgtcctcgacaacgtcactccagaagatgccggcaagtacacgtgcatcgttgagaacaccgccggaaaagatacctgtgaggcgacgctaactgtcattgaatcattggagaagaagtcggagaaaaaagctccagaattcattgttgctcttcaagataagacaacaaagacatccgagaaggttgttcttgaatgcaaagtcatcggagagccaaagccgaaagtcagctggcttcacgataataagacaattactcaagagtctatcacagttgaatcagtggaaggcgtcgaaagagtcacaatcacttcatctgaattgtctcatcaaggaaaatacacctgcattgccgagaacactgaaggaacatctaagactgaagcattcttgactgtccaaggcgaagctccagtgttcacaaaggaactgcagaacaaggagttatcaattggagagaagctcgttctctcgtgttctgtcaaaggatccccacagccgcatgtcgatttttattcgttctcggaaactacgaaggtggagacgaagatcacctcatccagtcgaatcgccattgagcatgaccagaccaatacgcattggagaatggttatcagtcaaatcacaaaagaagatattgtctcctacaaagctattgccacaaattcaattggaactgctacttcaacatcaaagatcaccacgaaggtagaggcaccagtctttgagcaaggattaaagaagacaagtgtgaaggagaaggaagaaattaagatggaagtaaaggtcggaggaagtgctccagatgttgaatggtttaaggatgacaaaccagtcagtgaagatggaaatcatgagatgaagaagaatccagaaactggagtgtttactctggttgtgaaacaagctgcaactacagatgctggaaagtataccgccaaggcttccaatccagcaggtactgctgaatcttctgcagaggctgaggtcactcaatctctcgagaaaccaactttcgtgagggaacttgtcacaactgaagtcaagatcaatgaaactgcaactttgtccgttacagtgaaaggagttccagatccgagtgttgaatggcttaaggatggacaaccagtgcaaactgattcaagtcatgtgattgctaaggttgaaggatccggaagctactcgattaccattaaggatgcgagactcgaggactctggaaagtacgcatgccgtgcaaccaatccagcaggtgaagccaaaactgaggctaactttgcagttgtcaagaacttggttccaccagaatttgttgagaaactcagtccactcgaagtgaaggagaaggaaagtaccaccttgtccgtcaaggttgtaggaacaccagaaccatctgttgaatggttcaaggatgatactccaattagtatcgacaatgttcatgtcattcagaagcagacagctgttggatccttcagtttaaccatcaatgacgcgagacagggagatgttggaatctactcttgccgtgctaggaatgaagctggggaagctcttacaacagcgaactttggaatcatcagggattctattccaccagagtttactcaaaaacttcgaccacttgaagtcagagagcaggagactcttgatttgaaagttactgtaattggaaccccagtaccaaatgttgaatggttcaaggatgataagccaatcaatattgataactcgcacatttttgcaaaggatgaaggatcaggacatcatactctcacaattaaacaagctagaggagaagatgttggagtctacacctgcaaagccaccaacgaagccggagaagccaaaaccactgcaaacatggctgttcaagaagagattgaagcaccattgtttgttcaaggcctgaaaccatacgaggtggaacaaggcaagccagctgaattggtggttcgtgtagaaggaaagccagagcctgaggttaaatggttcaaggatggagttccgattgctattgacaatcagcatgtgattgagaagaagggagagaatggatctcatactcttgtcatcaaagacaccaacaatgctgacttcggaaagtacacatgccaagctacaaacaaggctggaaaggatgaaactgttggagagctcaagattccaaagtattcattcgaaaagcaaactgctgaagaagtcaagccactgttcattgagccactaaaggaaacatttgccgttgaaggagataccgttgttcttgaatgcaaggtgaacaaggaatcacatccacaaatcaagttcttcaagaatgatcaaccagtggagattggacaacacatgcaattggaagtattggaagatggaaatatcaagctcacaattcaaaatgccaagaaagaagacgttggtgcatatcgttgcgaggctgtgaatgttgccggaaaggccaacacgaatgctgatttgaagattcaattcgctgctaaagttgaagaacatgtcaccgatgaaagtggccagcttgaggagattggacagtttgagactgtcggagatactgcatcctctaagaccgacactggacgtggagctccagaatttgtggagcttctccgttcgtgtacagttaccgagaagcaacaagcgatccttaagtgcaaggtgaaaggagagccacgaccaaagatcaagtggactaaggaaggaaaggaggtcgaaatgtcggcacgtgttcgcgctgagcacaaggatgatggaactttgacgctgacatttgataatgttactcaagccgacgccggagaatacagatgtgaggctgagaacgagtatggaagtgcatggaccgaagggccaattattgtcacattggaaggagctccaaagattgacggtgaagctccagacttcttgcaaccagtcaagccagctgttgttacagttggtgagactgcagttcttgaaggaaagatttctggaaaaccgaaaccaagtgttaaatggtacaagaatggagaagagctcaagccatccgatagagttaagattgagaatttggatgatggaactcaaagactcaccgttaccaacgctaaactcgacgatatggatgagtaccgctgtgaagcttcaaatgagtttggagatgtttggagtgacgtcactcttacagtcaaggaaccagctcaagttgctccaggattcttcaaggaactctctgctattcaggttaaggagactgaaaccgccaagtttgaatgcaaggtttcgggaactaagccagatgtgaaatggttcaaggacggaactccattgaaggaagacaaacgagtgcacttcgaatcaaccgacgatggaactcaaagacttgtcatcgaagattccaagactgatgatcaaggaaactaccgtattgaagtttccaatgatgctggagttgcgaacagcaaggttccactcacagtcgttccatcagaaaccctcaagatcaagaagggactcacagatgtaaatgttacacagggaaccaagatccttctctctgttgaagttgaaggaaaaccaaaaactgtcaaatggtacaagggaacagaaactgtcaccagctcccagaccacaaagatcgtgcaggtgaccgagtcagaatacaagttagaaatcgaaagcgctgagatgtctgatactggagcttaccgcgttgttctctctactgattcgttttctgttgagtcgtctgctacagtaactgtcaccaaggctgctgaaaagattagtcttccttcattcaagaagggactcgctgatcaatccgttccaaagggaactccattggttttggaagttgaaatcgaaggaaagccaaaagatgttaaatggtataagaatggagatgagatcaaggacgggaaggtcgaggatcttggaaacggaaaataccgactcacaattccagacttccaagagaaagatgttggagagtacagtgtcactgctgctaacgaggctggagaaattgaatcaaaggccaaggtaaacgtgagtgccaagcctgaaattgtttctgggctggtaccaactactgtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggaccagtcaagggagtcaagtggtacaagaacggaaaagagattcctgatgctaaaacaaaggacaatggagatggatcctactctcttgagattccaaacgctcaagttgaagatgcagctgactataaggttgttgtctccaatgatgctggagatgctgattcttcagctgctcttaccgtcaaacttgctgacgatggaaaggataaggtgaaaccagaaattgtatcgggacttattccaactacagtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggtccagtgaaacaggtcaagtggtataagaatggaaaagaaattcccaacgccaaggctaaggacaacggagatggatcctactctctggaaattccaaacgcgcaacttgatgacactgccgactacaaggttgttgtgtcgaatgatgctggagatgctgattcttcagctgctcttactgttaagcttcctggaatcgctattgttaagggacttgaagacgccgaagtgccaaagggcaagaaggctgttctccaagttgaaaccaacaagaagccaaaggaaattaaatggtataagaatggaaaggagattactccaagcgacaaggcacaacccggaagcgacggagacaacaaaccacagctggttattccagatgctggtgacgatgatgctgctgaatataaggttgtgttgactgatgaagatggaaatactgccgattcgtcatgcgccttgactgttaaattaccagcaaaagagccaaagatcatcaaaggactcgaggatcaagtggtgtcgattggatctccaattaagttggaaatcgaaacttctggatcaccgaagactgtgaaatggtacaaaaacggaaaggagcttccaggagctgccgccaagaccatcaagattcagaagatcgacgataacaagtatgttcttgagatcccatccagtgttgttgaagataccggagactacaaagtcgaagttgccaacgaggcaggatctgcaaacagcagtggaaagatcactgtggaaccaaagatcacgttcttaaagccactgaaggatcaatcgatcactgagggagaaaatgccgaattctcagttgaaaccaacaccaagccaagaattgtcaaatggtataagaatggacaagaaattaagccaaattcccgattcatcattgaacaaaagactgataccaagtatcaacttgttattaagaacgctgttcgtgatgatgcagacacctacaagattgttcttgaaaacaccgctggagaagccgaatcttctgctcaattgactgttaagaaagctaaggctggactctgcaagatcgtcaaaggtcttgaagaccaggttgttgccaagggtgccaagatggtatttgaggttaagatccaaggagagccagaggatgtcagatggcttcgtgatgcaaatgttatcagtgcaggagctaatgcaatcattgagaaaattgatgacaccacctacaggttgataattccatccgctgatttgaaggatgctggtgaatacactgtcgaagtaatcaatgagagtggaaaagccaagagtgatgcaaagggagaggttgatgagaaaccagagattgttcgaggacttgagaacatcgaaattccagagggagatgacgatgtgttcaaggttgaagtcagtgctccagtcagacaagtcaaatggtataaaaatgaccaggagatcaaaccaaacagccatttggaagccaaaaagatcggtccaaagaagtacgaacttgctatcaaccgtgctcaattggacgatggagccgactacaaggttgtgctatcgaatgctgcaggagattgtgattcttccgcggctctcactgttgtcaagccaaatgttctgaagattgtcgatggattgaaggatgttgatgttgaggaaccccaaccagttgaacttaaggtcaaggttgagggtattccaaaggttattaaatggtacaagaacggacaggagcttaagccagatgctgacggattcaaatttgaagagaaaccagaatctggagagttctctctcactatcccatcgtctaagaaatctgatgggggtgcataccgtgttgttcttggaaatgacaagggagaagtatacagtggatctgttgttcatgttaaatctgccaaatcatccgaaccaacatcaggagccaacttcctctccccactcaaggataccgaggttgaagaaggagatatgctcactcttcagtgcactattgctggagaaccattccccgaagtcatctgggagaaggatggtgttgtccttcagaaggatgatagaatcacgatgagagtcgcacttgatggtactgctaccctcagaattcgttctgccaagaagagtgacattggacaatatcgtgttactgcgaagaacgaagctggaagcgctacaagtgactgcaaggttaccgtcactgaacaaggagagcaaccatcgaagccaaagttcgttattccattgaagacgggagcagctcttccaggcgacaagaaggaattcaatgtgaaggttcgaggacttccaaagccaacattgcaatggttcttgaacggaatcccaatcaaattcgatgatagaatcaccctcgatgacatggctgatggaaactactgtcttacgattcgtgacgttcgtgaagaagacttcggaaccttgaagtgtattgcaaagaatgagaatggaacagatgaaactgtctgtgaattccaacaaggtgctggacacgatgatggatctagagacgatcttcgttatccaccaagattcaatgttccactttgggacagaagaatccctgttggtgacccaatgttcatcgagtgtcatgttgatgccaacccgaccgccgaagttgaatggttcaaggatggaaagaagatcgaacacactgcacataccgaaatcagaaacaccgttgatggagcatgtcgcatcaagatcattccattcgaggagtctgatattggagtttacatgtgcgttgctgtaaacgagttgggacaagctgaaactcaagccacataccaagttgagattttggaacatgtggaggaggagaagcgccgagaatatgctccaaagattaatccaccattggaagataaaactgtcaatggaggtcaaccaatcagattatcatgcaaggttgacgctatcccaagagcttcagtggtttggtacaaggatggacttccacttcgtgctgattctagaacctctattcaatatgaagaggatggtacagctacccttgcgatcaatgacagtaccgaggaagacattggagcataccgttgtgttgctacaaatgctcatggaacgatcaacaccagttgcagtgtgaacgtcaaggttccgaagcaggaagtcaagaaggagggagaagagccattcttcacaaagggacttgtcgatttgtgggcggatcgtggagattcgttcactttgaagtgcgcagtcaccggagatccattcccagaaatcaagtggtacagaaatggacaacttcttagaaatggaccaagaactgttattgaaacatcgccagatggttcatgttcacttactgtcaatgaatctacaatgagtgatgaaggaatctatcgatgtgaagctgaaaatgctcatggaaaggccaagactcaagctactgctcatgtgcaaatggctcttggaaagactgaaaaaccaaaaatggatgaaggaaaaccaccaaagttcattttggagctttctgatatgtcagtttctcttggaaatgttattgatttggaatgcaaggttaccggactaccaaatccatcagtcaaatggtcgaaggatggaggtccactgattgaggactccagattcgaatggtccaatgaagccagcaagggagtctatcagctcagaatcaagaacgccaccgtacatgacgagggaacttatcgctgcgttgccacaaatgagaatggaagtgctactaccaagtcatttgtaagaatggatgatggtcttggatcaggtgttgtgactgccagtcagccaccaagattcactttgaagatgggagatgttcgtacaactgaaggacaaccattaaaattggagtgtaaggttgacgctagcccacttccagagatggtttggtataaggatggagccattgttacaccatctgacagaattcaaattagtctgtcacctgatggagttgcaactcttcttatcccatcttgcgtctatgatgatgatggaatctaccgtgtaattgccaccaacccatctggaactgcccaggataagggaactgctactgttaagaaacttccaagagatagcggtgccagaaggtctgctgacagagatgtatttgatgctaacaaggcaccaaagcttatggagccactggagaatatcagaattcccgaaaagcagtcgttccgtcttcgttgcaagttcagcggagatccaaagccaacaatcaaatggttcaaggatggagaacgtgtattcccatacggacgtcttcaactcatcgagtctccagatggtgtctgtgagttggtggttgattctgccactcgtcaagatgctggaggatacagatgcgttgctgaaaacacttatggatctgctagaacatcttgcgatgttaatgttattcgcggtgatcgtaagccacgcgacattgactcgtccattcgtgaaggaaaggctccaggattcaccaccccattgacaatccgtcgtgctaagccaggagattccgtgacattcgaatgccttccattcggaaatccattcccatcaatcaagtggcttaaggatggacttgagctgttctctgatgaaaagatcaagatggaagctgctgcagatggaacccagcgactcattctttccgatgtcaccttcttgagtgaaggatacttcagatgtgtagctaccaatgagcatggaactgcttctacaaaggctgaacttgtcatcgaaggagaccgaactattggatcccgcccacttccagaagtaaacggagagcctgaagaatgcaagccaagaatccgtcgtggactgtacaacatgagtattcacgagggtaatgttgtggagatgatcgtctgtgcaactggtatcccaacgccaactgtcaagtggtacaaggatggacaggagattgtcggagatggacctgatggaaagagggtcatctttacggatgaacgaggaattcatcacttggttattgtgaatgcatctccagatgatgaaggagagtactcgttggaagcaacgaataagttgggatcagccaagaccgaaggatccttgaacattatcagaccaagacatattgcagatgctgacgagagaggaggcatgccattcccaccaggattcgtgcgtcaactaaagaacaagcacgtcttcaatcacatgccaacaatcttcgactgccttgttgtcggacacccagcccctgaagtagagtggttccacaatggaaagaagattgttccaggaggacgaatcaagattcaatcgtgtggaggaggatctcatgccctcatcattctcgatacaacccttgaagatgcaggagagtacgttgctactgcgaagaactctcatggatccgccagctcatcagcagtgcttgatgtgactgttccattcctggacagcatcaagttcaatggagagattgatgtgactccatacctcaccgaggaatatggattcaagaagcttaacaccgccagtctcccaactccaccagatcgtggaccattcatcaaggaggtcaccggacattatcttacactctcatggattccaacaaagagagctccaccacgttatccacaagtcacatatgttattgagattcgtgaacttccagagaaacaatggtctctcttggagtataacattccagagccagtatgcaaggttcgtaatttggaactcggaaagtcatatcaattccgtgttcgtgctgagaacatctatggaatctctgatccatcgccagcatctccaccatcaagactcatggctccaccacaaccagtattcgatagaagaacgaacaaagttattccacttcttgacccatatgcagaaaaagctcttgatatgagatactctgaacagtacgcgtgtgctccatggttctcaccaggagtcgttgagaagcgatactgcgccgagaacgataccctcacaattgttctgaatgtgtccggattcccggatccagatatcaaatggaagttccgtggatgggatattgacacgtcatcgccaacctctaaatgcaaagtgtacacttatggaggttccgagacaacattagccatcactggattcagcaaggagaatgttggacaatatcaatgtttcgccaagaacgattacggagatgcacaacaaaatattatggttgatcttgcaacacgaccaaacttcatccaaccactcgtgaacaagaccttctcatcagctcagccaatgagaatggacgtgagagtcgacggagaacctttcccagaattgaaatggatgaaggaatggcgcccaattgtcgagtcgtctcgcatcaagtttgttcaagacggaccttatttgtgctctttgatcattaatgatccaatgtggagagactccggaatctattcatgtgttgctgtaaatgatgccggacaagccacgacgtcgtgtactgttactgttgaagctgaaggcgactacaatgacgtcgaacttccccgtcgccgagtgacaatcgaatcgcgacgagtgcgagagctctacgaaatctctgaaaaagacgaaaagtaattaaaagcaaaaagtgttatttttgccatatgtctacaacaaaattatatgtatcaagtgtttttttttctgtttttttttcttcttaaaaattttaaattgcccaccttttttttaaattgtaccaagtaatttttctgaagttttaatttttttttccaaaattcgaaaaccgtcaagaacaactgcgaagtgcccaatcgctaaagttcttgacttatattcttcaaaaaaactttaaaatccagaaacattacttttcagtcgcttataccggttaagacccttttcatatacattttccctcagctttcatgttccagtgaaaatcccttccgcccagtaggagtgaaatcccatgcaaattcacacccgattcgattcgaaacttcgctcagttttttctttccttttattaatttttaaattttcttgttgcatactcccggtagtaaatttcgcctagtcccatttgccatgtggcaagtgcccaatgccacgtggcacccaaaacccgtgccccaccaatcccttccaatgaccaacactacccgtttgctcaattttatcgtttttctttttaattgcccgatttttatttctttacgatcatatcactttctcttctttcccccgaaaatgtttcaatcctcctctcaaaaataaagattgactaact
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]