2024-05-18 19:47:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_120460 1169 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana homeobox 51 (HB51), mRNA. ACCESSION NM_120460 VERSION NM_120460.5 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 1169) AUTHORS Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E., Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K., Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S., Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M., Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R., Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J., Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J., Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L., Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B., Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E., Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A., Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M., See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L., Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R., Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R., Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N., Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B., Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H., Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W., Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M., Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S., Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K., Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C., Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P. CONSRTM Kazusa DNA Research Institute; Cold Spring Harbor and Washington University in St Louis Sequencing Consortium; European Union Arabidopsis Genome Sequencing Consortium TITLE Sequence and analysis of chromosome 5 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 823-826 (2000) PUBMED 11130714 REFERENCE 2 (bases 1 to 1169) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1169) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 1169) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003076). On Sep 12, 2016 this sequence version replaced NM_120460.4. FEATURES Location/Qualifiers source 1..1169 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="5" /ecotype="Columbia" gene 1..1169 /gene="HB51" /locus_tag="AT5G03790" /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM IDENTITY1; LMI1" /note="Encodes a homeodomain leucine zipper class I (HD-Zip I) meristem identity regulator that acts together with LFY to induce CAL expression. It binds to the CAL promoter proximal CAATNATTG element. LMI1 acts primarily downstream of LFY in meristem identity regulation. The interaction between LFY, LMI1 and CAL resembles a feed-forward loop transcriptional network motif. The gene also had additional LFY-independent roles in leaf morphogenesis and bract formation." /db_xref="Araport:AT5G03790" /db_xref="GeneID:831723" /db_xref="TAIR:AT5G03790" CDS 204..911 /gene="HB51" /locus_tag="AT5G03790" /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM IDENTITY1; LMI1" /inference="Similar to RNA sequence, EST:INSD:EL982910.1,INSD:DR749928.1,INSD:DR750589.1, INSD:DR750590.1,INSD:ES081691.1" /note="homeobox 51 (HB51); FUNCTIONS IN: sequence-specific DNA binding, DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox, conserved site (InterPro:IPR017970), Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Helix-turn-helix motif, lambda-like repressor (InterPro:IPR000047), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: homeobox protein 22 (TAIR:AT2G36610.1); Has 11020 Blast hits to 10992 proteins in 578 species: Archae - 2; Bacteria - 0; Metazoa - 8622; Fungi - 156; Plants - 2028; Viruses - 0; Other Eukaryotes - 212 (source: NCBI BLink)." /codon_start=1 /product="homeobox 51" /protein_id="NP_195999.2" /db_xref="GeneID:831723" /db_xref="TAIR:AT5G03790" /db_xref="Araport:AT5G03790" /translation="
MEWSTTSNVENVRVAFMPPPWPESSSFNSLHSFNFDPYAGNSYTPGDTQTGPVISVPESEKIMNAYRFPNNNNEMIKKKRLTSGQLASLERSFQEEIKLDSDRKVKLSRELGLQPRQIAVWFQNRRARWKAKQLEQLYDSLRQEYDVVSREKQMLHDEVKKLRALLRDQGLIKKQISAGTIKVSGEEDTVEISSVVVAHPRTENMNANQITGGNQVYGQYNNPMLVASSGWPSYP"
misc_feature order(432..440,444..446,495..497,513..515,552..554, 558..563,570..575,579..587,591..596) /gene="HB51" /locus_tag="AT5G03790" /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM IDENTITY1; LMI1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 432..593 /gene="HB51" /locus_tag="AT5G03790" /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM IDENTITY1; LMI1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(432..434,441..443,561..563,570..575,582..584) /gene="HB51" /locus_tag="AT5G03790" /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM IDENTITY1; LMI1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 597..701 /gene="HB51" /locus_tag="AT5G03790" /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM IDENTITY1; LMI1" /note="Homeobox associated leucine zipper; Region: HALZ; pfam02183" /db_xref="CDD:426641" ORIGIN
tccaaaagacaaagtacatagaagaagaaacttcttgtcacgcctctcttaccccttcccttgtggtccaataaaaccctaattttcttttctttcttttatccattgtattagatcctatatctttcttccttatagaccatctctcatgtcttcttatatatattaagatattcacaagaactacaaaagaaagaaaggagatggagtggtcaacaacgagcaacgtagaaaacgtgagagtagctttcatgccaccgccatggccggagtctagttcctttaactcgctccacagcttcaactttgatccttacgcaggaaattcatatacgcctggcgatacacaaaccggaccggttatctctgtaccggaatcagaaaagatcatgaatgcgtaccgatttccgaacaacaacaatgagatgataaaaaagaagagactaacgagtggacaattagcttcacttgagcgaagttttcaagaagagatcaaattagattcagacaggaaggtgaagctgtcgagagagctcggtctgcagccacgtcagatagcagtttggttccaaaaccgccgtgcacggtggaaggcgaagcagcttgagcagttgtacgactcgcttagacaagagtacgacgtcgtttctagggagaaacaaatgttacacgatgaggtgaagaagctgagagctttactaagagaccagggtttgatcaagaagcaaatctctgccgggaccatcaaagtttccggtgaggaagacacggtggagatttcatcggtggtggtagctcatccaagaacggagaatatgaacgcaaatcaaatcaccggagggaatcaagtttacggtcaatacaacaatccgatgctggttgcttcctctggctggccgtcatacccctgatagatgttgctgatctcagagagagggaaagagaatgagagaacgagagaaagagagagagagagattgtgtcaaatagagctttagactaggactttagtagtgttatagactaagacaagctttctctcattgtacgatcttaaaacataaatggcacgttcttggatgcgagattgagtctgaaaattgttgagttggttttgttgaacaactatactatgaacactcagaattggcgaatgtccgaaacaaaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]