2024-05-20 12:54:34, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_061078957 1176 bp mRNA linear VRT 21-NOV-2023 DEFINITION PREDICTED: Limanda limanda vimentin-related 2 (vimr2), mRNA. ACCESSION XM_061078957 VERSION XM_061078957.1 DBLINK BioProject: PRJNA1040927 KEYWORDS RefSeq. SOURCE Limanda limanda (common dab) ORGANISM Limanda limanda Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei; Pleuronectidae; Limanda. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_083645) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_963576545.1-RS_2023_11 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 11/17/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1176 /organism="Limanda limanda" /mol_type="mRNA" /db_xref="taxon:27771" /chromosome="10" gene 1..1176 /gene="vimr2" /note="vimentin-related 2; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins" /db_xref="GeneID:133011268" CDS 1..1176 /gene="vimr2" /codon_start=1 /product="peripherin" /protein_id="XP_060934940.1" /db_xref="GeneID:133011268" /translation="
MAMLRVSSYRRLFEEETWGRSGGLSSPCAGQYQASVRRAAADKCDCDCEQLDFVAAKSLNKEGLTRFALDRSVIAALNDRLVGLIELARCFEEENDSLECQIVELEEKQSSRPAASSSITSAVAPPDFSLDAVVERLRRERDEILCDTEELHKELERLQSSYEELAQQRVFYLQEQQDVAEVVDAVTAECLALREQVAIYEEQLANMEARHKTEVESLQDPADWTTGAAAALGFCSPDMTPVLDVKEFYCQLAESLQFGAASSAAVRGGDRKQLEVGAAEGSKVTDSPKIQDVGELKMLISELQKEIVELEKYNEELEDEVEMKTSAHMDEIADLKFTMDEMRQQEADFQVQMKEQCEDYKELLSEKMARDMEIVAYRSLLEDEEERLCDL"
ORIGIN
atggccatgctcagggtgtcttcctaccggaggctgtttgaggaggaaacgtggggtcgaagtggagggttgagttcaccgtgtgctgggcagtatcaggcctctgtcaggcgtgcggccgccgacaagtgcgactgtgactgtgagcagctggactttgtcgccgccaagtctctgaacaaggagggtctgacccggttcgccctggaccgcagcgtcatcgctgccctcaacgaccgcctggtcggccttatagagctggctcgttgtttcgaggaggagaatgattcgctggaatgtcagattgtggagctggaggagaagcagagcagtcgcccagccgcatcctcctccatcacctccgccgtggctccacctgacttcagcctggatgcagtggtggagagactgcgcagggagcgggacgagattctgtgcgacaccgaggagctgcacaaggagctggagcgtctgcagagcagctacgaggagctggcacagcagagagtcttctacctgcaagagcagcaggatgtggctgaggtcgtggatgctgtgacagcagagtgtctggcgctgagggagcaagtggctatctacgaggagcagctggccaacatggaggcccggcacaagacggaggtggagagtctgcaggatccagccgactggaccacaggagcagctgcagctcttggattctgcagcccggacatgactccggtcctggatgtgaaggagttctactgccagctggctgagagtctccagttcggagctgcctcctctgctgcagtacgcggtggtgatcgaaaacaactggaagtgggagctgccgaagggtcaaaggtcacagactcgccaaagatacaggacgtcggtgagctgaagatgctgatttccgagctacaaaaggagattgtggagcttgagaagtataatgaggagctggaggatgaggtggagatgaagacatctgcacacatggacgagattgctgatttgaagttcaccatggatgagatgcggcagcaggaggccgacttccaggtacagatgaaggagcagtgtgaagactacaaggagctgctcagtgagaagatggccagagacatggagattgttgcctacaggagtctgttggaggatgaagaggagaggctgtgcgacctgtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]