GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 16:27:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_060926917            1401 bp    mRNA    linear   VRT 13-NOV-2023
DEFINITION  PREDICTED: Neoarius graeffei vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_060926917
VERSION     XM_060926917.1
DBLINK      BioProject: PRJNA1037146
KEYWORDS    RefSeq.
SOURCE      Neoarius graeffei (lesser salmon catfish)
  ORGANISM  Neoarius graeffei
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes;
            Ariidae; Neoarius.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083576) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_027579695.1-RS_2023_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/10/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1401
                     /organism="Neoarius graeffei"
                     /mol_type="mRNA"
                     /isolate="fNeoGra1"
                     /db_xref="taxon:443677"
                     /chromosome="8"
                     /tissue_type="blood"
                     /dev_stage="subadult"
                     /country="Australia: Ayr"
                     /lat_lon="19.567261 S 147.423886 E"
                     /collection_date="2020-08-07"
                     /collected_by="Aaron Davis"
     gene            1..1401
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 3
                     Proteins"
                     /db_xref="GeneID:132890130"
     CDS             18..1187
                     /gene="vimr2"
                     /codon_start=1
                     /product="glial fibrillary acidic protein"
                     /protein_id="XP_060782900.1"
                     /db_xref="GeneID:132890130"
                     /translation="
MAMLRVSSYRKLFEAEHQRPASWLSQRCGTQILPSSARGGFSTIDWPEPDFSAARALNREGLMRFSQERSIIAALNDRLAVLIDMVRCLEEENESLEAQVIEMEERSAAKPTPSSSISLNCRSDSSLEATIERLRTEKDEILCRREALTKDLHDIKIKYDEVVKQRTHFQLEREHVAMEVDTVTADCLALREQVAIYEEQLSAMKQQHELGIESVCEPPAEYQDDPAVSLKFPSIDLTPAITIIKDYYCQLAESLQFESGSVAIARGEEKGRILETSTGGKVKDYPEVMDVNGLKELIAKLQKELAELLACGEDLGAEIEAKKQAHLLEIEELETCIHRLEKEEADLQTQVKDQMEDYEELLNEKMARDIEIKAYRALVEVEEERLCCL"
ORIGIN      
gtagctttggagcagccatggccatgctgagagtgtcctcatatcgcaaactgtttgaggcggagcatcagagaccagcttcatggctcagtcagcgctgtggaacccagatcctcccctcttctgccaggggtggattttccacgatcgactggcctgaaccagacttctctgcagctcgagctttaaacagagagggtctgatgcgtttctcccaggagcgctccataatcgccgccctgaacgatcgtctggcggttcttatcgacatggtacgatgtctggaagaagagaatgagtctttggaggctcaggttattgagatggaagagagatcggcagccaagccaaccccctccagctctatcagtctcaactgtcgctcagactccagcctggaggccacgattgagagactgcgcacggagaaggatgagattctgtgtcgcagagaagcgctgacgaaagacctgcacgatataaaaataaagtatgatgaggtcgtgaagcaacggactcacttccaactggaacgcgagcatgttgccatggaggtggatacggtgactgctgactgcttggcactcagagaacaagtggcaatctatgaggagcagttatctgccatgaagcaacagcatgagttggggattgagagtgtgtgtgagcctccagctgaatatcaggatgatccagctgtctctctgaaattcccctccatcgatctcactccagccatcacgattatcaaggactactactgccagctggctgaaagcctacagtttgagtccgggtccgttgcaattgccagaggagaagagaaggggaggatcttggaaacgtctactggagggaaggttaaggattatccggaggtgatggacgtgaatggtctgaaggagctgattgctaagttgcagaaggagcttgctgagctgctggcatgtggtgaagacctgggggcagaaattgaagcaaagaaacaggctcatctgctggagatcgaggagttggaaacctgcatccaccggctggagaaagaagaggctgacttacaaacacaggtgaaggaccagatggaagactatgaggaactgctcaatgagaagatggcacgggacatagaaattaaagcctacagggctttggtggaggtggaggaggagagactgtgctgcctgtgagacagagaggcccagcacacaatatatgatatgatatcttgtgtattgctgctgaactattacgcatttacatcaagttgcacattttaaaaggcgtctgtatcttgtaactcctctcatcggcagtcttatcaacgacacatacggtatgggtgtattttaaagttaaaccttttctgacttgcatgataatcctaatcctgggaatggataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]