GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 17:46:57, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_056948580            2832 bp    mRNA    linear   PLN 06-JUN-2023
DEFINITION  Penicillium hispanicum uncharacterized protein (N7459_009412),
            partial mRNA.
ACCESSION   XM_056948580
VERSION     XM_056948580.1
DBLINK      BioProject: PRJNA973687
            BioSample: SAMN30185340
KEYWORDS    RefSeq.
SOURCE      Penicillium hispanicum
  ORGANISM  Penicillium hispanicum
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Penicillium.
REFERENCE   1  (bases 1 to 2832)
  AUTHORS   Petersen,C., Sorensen,T., Nielsen,M.R., Sondergaard,T.E.,
            Sorensen,J.L., Fitzpatrick,D.A., Frisvad,J.C. and Nielsen,K.L.
  TITLE     Comparative genomic study of the Penicillium genus elucidates a
            diverse pangenome and 15 lateral gene transfer events
  JOURNAL   IMA Fungus 14 (1), 3 (2023)
   PUBMED   36726175
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2832)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (06-JUN-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2832)
  AUTHORS   Petersen,C.
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2023) Department of Chemistry and Bioscience,
            Aalborg University, Fredrik Bajers Vej 7H, Aalborg, Nordjylland
            9220, Denmark
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_026623200).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2832
                     /organism="Penicillium hispanicum"
                     /mol_type="mRNA"
                     /strain="IBT 35686"
                     /culture_collection="IBT:35686"
                     /db_xref="taxon:1080232"
                     /chromosome="Unknown"
     gene            <1..>2832
                     /locus_tag="N7459_009412"
                     /db_xref="GeneID:81638832"
     CDS             1..2832
                     /locus_tag="N7459_009412"
                     /note="Argonaute linker 1 domain; Argonaute linker 2
                     domain; N-terminal domain of argonaute; PAZ domain; Piwi
                     domain"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_056795805.1"
                     /db_xref="GeneID:81638832"
                     /translation="
MSQPRGRGGAPRGNFRGGGGFSGRGGRGGYGGAGRGAPSGPNLMFQDVPVIDNAIQAFEDQCVQQNKSAPLQEKELVRRPGYGVQGRKIILRANFFSLDFSPNAPGFYCHKVVIKPEPSPRRHARQLFEQLMRTEEIAPLGAATDGSTEIVCTTKIVFNPRDFTVDKKDNGGGKSYRISLNEPELIKHVDLVSALKNAKPTGSSAFENAAIRALNILMTGAPSKDLGVVIKGKGCKFFWTDNRKQVADLKGGLECIRGFFSSIRPAAGRVLINMNTNHSAFYRPGPLFWLLGDFNDVFGKDNILLNRYIRGVRVELTHLPLQTKDDGSQGLRQKSIWGLASPRDGSRTENPPRVPHLGANADLVEFYMEEHNTGKGRYISVTDYYKKTYNMVLKNRTMPVVNVGSSDKPTYLPADVCKILPGQIYNGELGTTQRQNIINFSCRRPPDNFNSINSDGMKIMGVTDTRTQKFGIQVNPGMVAVPGRILNPPSLKYGTTWQVPSKGSWNLVGKKFCEGAVIKSWTGVLLQKKGFSLPGSNTTTPELNRALEKFWTCAKNLGISWPKPSPCAFLGFERDQMHERVDEMFRKAATHLSFIVVLLPMQEDRVFNYIKWVGDTRAGILTHCCSASKFLQGNDQYLANNAMKVNLKMGGICQSLEMPQSSRLLNAGKTMVVGLDVTHPSPTDTEAFPSIACIVASIDSRVGQWPGEARIQMRRVETIQPLQAMMGNCLERWVKKNKQLPLNILIYRDGVSEGQYQMVLNEELKSIKTAAQLLYKGRPPNITIVVCGKRHNVRFFPTRESDADRTNNPLNGTVVDRVVTRPQLWDFYLQAQAPIQGSARPAHYVVIHDEIFTNPAANPDHMKPADTLQELTHNICYMMGRCTRSISYSTPAFLADKFCDRARKYVRAHFTKEMETRDSAALSTPPQSVVKLADQIIDSMVYI"
     misc_feature    706..849
                     /locus_tag="N7459_009412"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    859..1260
                     /locus_tag="N7459_009412"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1000..1002,1096..1098,1141..1143,1153..1155,
                     1207..1209,1228..1230,1234..1236)
                     /locus_tag="N7459_009412"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1402..2715
                     /locus_tag="N7459_009412"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1819..1821,1831..1833,1867..1878,1885..1887,
                     1909..1911,1918..1920,1930..1932,1942..1944)
                     /locus_tag="N7459_009412"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2026..2028,2032..2034,2245..2247,2686..2688)
                     /locus_tag="N7459_009412"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atgtctcagcctcgtggacgtggaggagcccctcggggcaatttccgtggcggcggtggtttttctggccgtggaggacgtggaggctacggcggcgccggtcgtggtgctccatcaggccccaacctgatgtttcaggatgttcctgtcatcgacaatgcgatccaagccttcgaggaccaatgtgttcagcagaacaaaagtgcccctctccaggagaaggagctggtccgacgcccgggttatggtgttcagggacggaagattatcctgcgcgccaacttcttcagtcttgacttcagcccaaatgctccaggtttctactgtcataaagtagtcatcaagcccgaaccatctccccggcgacatgcgaggcagctgttcgagcaactcatgcggactgaagagattgctccgcttggtgctgctaccgatggtagcactgagattgtctgcaccaccaagattgtcttcaaccctcgtgattttacggttgataagaaagacaacggtggaggcaaatcgtaccggatttccttgaatgagccagagctcatcaaacatgtggacttggtttcagcgctgaagaatgcgaaaccaacgggctcttctgccttcgaaaatgccgccattcgagctttgaacattctgatgaccggtgccccttcgaaggatctcggcgtcgttatcaaaggaaagggctgcaagttcttttggaccgacaatcgaaagcaggtcgccgatctcaagggcggactcgagtgcatccggggcttcttttcaagcattcgccccgctgctggtcgagtgctgatcaatatgaacaccaaccacagcgctttctatcgccctggtcccttgttttggttgctcggtgactttaacgacgtgtttgggaaggacaacattctcttgaaccgctatattcgcggtgtccgcgttgagctgacccatctgcctcttcaaacaaaggacgacggatcacagggccttcgacagaagtctatctggggcctggcttcacctcgcgatggatctcgaaccgagaatccccctcgggttccgcaccttggggccaacgctgaccttgttgagttctacatggaggaacataacactggcaaaggtcgttacattagtgtcactgattactacaagaagacctataacatggtcctcaaaaaccgtactatgcctgtggtcaacgtgggaagttcggacaagccgacttatttgccagcagacgtttgcaaaatcctcccaggacaaatctacaacggtgagcttggaaccacgcagcgacagaacatcatcaatttcagttgccgccgtccaccagacaacttcaactccattaacagcgatgggatgaagatcatgggtgttactgatacccggacccaaaaatttgggatccaggtcaaccccggcatggttgcagttcctggacgcattctcaaccccccaagtctgaagtatggtactacatggcaggttcccagcaaaggcagttggaatcttgtgggaaagaagttctgcgaaggggccgtgatcaagagctggactggagtcctgctccagaaaaagggctttagtctgcctggaagcaacacgactacacccgagctgaaccgggcgcttgaaaagttctggacttgtgcgaagaacttgggtatttcctggcctaaaccgagtccttgtgcattcctggggttcgaaagagaccagatgcatgaacgagtcgatgaaatgttccgaaaggcggctacgcacctttccttcattgtggtcttgcttcccatgcaggaggaccgtgttttcaactacatcaaatgggtcggtgatactcgggctggcattctaacccactgttgctctgcctccaaattcctccaaggcaatgatcagtacctcgcaaacaatgccatgaaggtaaacctgaagatgggtggcatctgccagtccctggaaatgcctcagtcttctcgcctgttgaatgctggaaaaaccatggtcgtcggcctcgacgtcacacacccttctcctactgacactgaagcatttcctagcatcgcatgcatcgttgccagcattgattcccgcgtcggccagtggccgggcgaagctcgcatccaaatgcgccgcgttgagactatccagcctctccaagcgatgatgggaaattgcctagagcggtgggtcaagaagaacaagcagctcccgctcaacatcctcatctaccgggatggcgtcagcgaaggccaataccagatggtcctgaatgaagaactgaagtccatcaagaccgcagcgcagctcctgtacaagggtcgcccgcccaacatcaccatcgtcgtctgcggcaaacgtcacaacgtccgctttttcccaacccgagaatccgatgctgaccgcactaacaacccactcaacggaaccgtcgtggaccgagttgtcactcgtccgcagctgtgggatttctatctccaggcacaggcgcctattcagggatccgctcgaccggctcactacgttgtcattcatgacgagatctttaccaaccctgctgctaacccagaccacatgaagcccgccgacacgctccaggaactgacccacaacatctgctacatgatgggccgctgcactcgctcgatctcctacagcactcccgccttcctcgccgacaagttctgtgaccgcgcgcgcaagtacgtgcgtgctcacttcaccaaggaaatggaaacccgcgacagcgccgccctgtccactcctcctcagagtgtggttaagctggctgaccagatcatcgatagcatggtctatatctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]