2024-05-20 14:46:54, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001368355 1946 bp mRNA linear ROD 08-AUG-2023 DEFINITION Mus musculus double C2, alpha (Doc2a), transcript variant 2, mRNA. ACCESSION NM_001368355 VERSION NM_001368355.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1946) AUTHORS Wang QW, Qin J, Chen YF, Tu Y, Xing YY, Wang Y, Yang LY, Lu SY, Geng L, Shi W, Yang Y and Yao J. TITLE 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin JOURNAL Cell Rep 42 (7), 112691 (2023) PUBMED 37354460 REMARK GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin. REFERENCE 2 (bases 1 to 1946) AUTHORS Bourgeois-Jaarsma Q, Miaja Hernandez P and Groffen AJ. TITLE Ca2+ sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons JOURNAL Mol Cell Neurosci 112, 103613 (2021) PUBMED 33753311 REMARK GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons. REFERENCE 3 (bases 1 to 1946) AUTHORS Diez-Arazola R, Meijer M, Bourgeois-Jaarsma Q, Cornelisse LN, Verhage M and Groffen AJ. TITLE Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons JOURNAL J Neurosci 40 (13), 2606-2617 (2020) PUBMED 32098902 REMARK GeneRIF: Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons. REFERENCE 4 (bases 1 to 1946) AUTHORS Bourgeois-Jaarsma Q, Verhage M and Groffen AJ. TITLE Doc2b Ca2+ binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength JOURNAL Sci Rep 9 (1), 14408 (2019) PUBMED 31594980 REMARK GeneRIF: Doc2b Ca(2+) binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength. Publication Status: Online-Only REFERENCE 5 (bases 1 to 1946) AUTHORS Courtney NA, Briguglio JS, Bradberry MM, Greer C and Chapman ER. TITLE Excitatory and Inhibitory Neurons Utilize Different Ca2+ Sensors and Sources to Regulate Spontaneous Release JOURNAL Neuron 98 (5), 977-991 (2018) PUBMED 29754754 REMARK GeneRIF: Doc2alpha promoted glutamatergic spontaneous neurotransmitter release, while Doc2beta and syt1 both regulated GABAergic spontaneous neurotransmitter release. REFERENCE 6 (bases 1 to 1946) AUTHORS Groffen AJ, Friedrich R, Brian EC, Ashery U and Verhage M. TITLE DOC2A and DOC2B are sensors for neuronal activity with unique calcium-dependent and kinetic properties JOURNAL J Neurochem 97 (3), 818-833 (2006) PUBMED 16515538 REFERENCE 7 (bases 1 to 1946) AUTHORS Toonen RF, de Vries KJ, Zalm R, Sudhof TC and Verhage M. TITLE Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1 targeting and SNARE complex formation JOURNAL J Neurochem 93 (6), 1393-1400 (2005) PUBMED 15935055 REFERENCE 8 (bases 1 to 1946) AUTHORS Bouwman J, Maia AS, Camoletto PG, Posthuma G, Roubos EW, Oorschot VM, Klumperman J and Verhage M. TITLE Quantification of synapse formation and maintenance in vivo in the absence of synaptic release JOURNAL Neuroscience 126 (1), 115-126 (2004) PUBMED 15145078 REFERENCE 9 (bases 1 to 1946) AUTHORS Sakaguchi G, Manabe T, Kobayashi K, Orita S, Sasaki T, Naito A, Maeda M, Igarashi H, Katsuura G, Nishioka H, Mizoguchi A, Itohara S, Takahashi T and Takai Y. TITLE Doc2alpha is an activity-dependent modulator of excitatory synaptic transmission JOURNAL Eur J Neurosci 11 (12), 4262-4268 (1999) PUBMED 10594652 REFERENCE 10 (bases 1 to 1946) AUTHORS Naito A, Orita S, Wanaka A, Sasaki T, Sakaguchi G, Maeda M, Igarashi H, Tohyama M and Takai Y. TITLE Molecular cloning of mouse Doc2alpha and distribution of its mRNA in adult mouse brain JOURNAL Brain Res Mol Brain Res 44 (2), 198-204 (1997) PUBMED 9073161 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC124505.4. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR7345562.3021039.1, SRR10662772.4242622.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164131, SAMN01164132 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-46 AC124505.4 188485-188530 47-336 AC124505.4 189341-189630 337-416 AC124505.4 189988-190067 417-491 AC124505.4 190250-190324 492-601 AC124505.4 190430-190539 602-728 AC124505.4 191702-191828 729-788 AC124505.4 191908-191967 789-952 AC124505.4 192051-192214 953-1034 AC124505.4 192305-192386 1035-1131 AC124505.4 192477-192573 1132-1946 AC124505.4 192659-193473 FEATURES Location/Qualifiers source 1..1946 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 69.25 cM" gene 1..1946 /gene="Doc2a" /note="double C2, alpha" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" exon 1..46 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 47..336 /gene="Doc2a" /inference="alignment:Splign:2.1.0" CDS 60..1277 /gene="Doc2a" /note="doc2-alpha" /codon_start=1 /product="double C2-like domain-containing protein alpha" /protein_id="NP_001355284.1" /db_xref="CCDS:CCDS21847.1" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" /translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGGGTGCGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEIELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWNDCLHQPDTALERWHTLTSELPPAAGAYPLA"
misc_feature 60..341 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D and DYNLT1. /evidence=ECO:0000250" misc_feature 159..221 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 342..713 /gene="Doc2a" /note="C2 domain first repeat present in Rabphilin and Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035" /db_xref="CDD:176000" misc_feature order(432..434,450..452,615..617,621..623,639..641) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176000" misc_feature 717..1274 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D. /evidence=ECO:0000250" misc_feature 834..1232 /gene="Doc2a" /note="C2 domain second repeat present in Rabphilin and Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384" /db_xref="CDD:176030" misc_feature order(918..920,936..938,1098..1100,1104..1106,1122..1124) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176030" exon 337..416 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 417..491 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 492..601 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 602..728 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 729..788 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 789..952 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 953..1034 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1035..1131 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1132..1946 /gene="Doc2a" /inference="alignment:Splign:2.1.0" ORIGIN
ggggaacaccgggcgcctctcgcggaggtgcacgccaagttctcggtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccgcttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]