2025-09-16 16:41:21, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XR_011995229 242 bp RNA linear MAM 01-APR-2025 DEFINITION PREDICTED: Vulpes vulpes uncharacterized lncRNA (LOC140594440), ncRNA. ACCESSION XR_011995229 VERSION XR_011995229.1 DBLINK BioProject: PRJNA1241828 KEYWORDS RefSeq. SOURCE Vulpes vulpes (red fox) ORGANISM Vulpes vulpes Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Vulpes. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_132790) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_048418805.1-RS_2025_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/26/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..242 /organism="Vulpes vulpes" /mol_type="transcribed RNA" /isolate="BD-2025" /db_xref="taxon:9627" /chromosome="11" /sex="female" /cell_line="fibroblast" /tissue_type="cell line" /dev_stage="adult" /geo_loc_name="Russia: Novosibirsk" /collection_date="2008" gene 1..242 /gene="LOC140594440" /note="uncharacterized LOC140594440; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:140594440" ncRNA 1..242 /ncRNA_class="lncRNA" /gene="LOC140594440" /product="uncharacterized lncRNA" /db_xref="GeneID:140594440" ORIGIN
cagggagcccgatgtggcactcgatcccgggactccaggatcacaccctgagccgaaggcagacgctcaaccactgagccaccaggcgtcccaattataaaaggttattaatttgaccatttaacctttctatcatcctattttttaaaaagctgaggtcatccatgtgctttctctgatgtgcctgttgcaagaagagattgattccagacaagtgaaacatacctgaagattctggcccg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]