2025-04-20 18:58:09, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XR_011727899 404 bp RNA linear VRT 03-MAR-2025 DEFINITION PREDICTED: Heliangelus exortis uncharacterized lncRNA (LOC139800744), ncRNA. ACCESSION XR_011727899 VERSION XR_011727899.1 DBLINK BioProject: PRJNA1226279 KEYWORDS RefSeq. SOURCE Heliangelus exortis ORGANISM Heliangelus exortis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Strisores; Apodiformes; Trochilidae; Heliangelus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_092432) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_036169615.1-RS_2025_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/24/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..404 /organism="Heliangelus exortis" /mol_type="transcribed RNA" /db_xref="taxon:472823" /chromosome="11" gene 1..404 /gene="LOC139800744" /note="uncharacterized LOC139800744; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:139800744" ncRNA 1..404 /ncRNA_class="lncRNA" /gene="LOC139800744" /product="uncharacterized lncRNA" /db_xref="GeneID:139800744" ORIGIN
ccttttgccccttggtatctttgttctcttaagaggagtgattgaatgctaatgaagcaaggagaaaccgtagctgccttcagtcttctatctcagctctgttctgcagcactgccagctgctctgggctgctctcatttccacaatccttagctggttaactgggacatgctgagagcagacagctctgacaaccttgctgctggagcctttctcttcattcaaaatttgtgcagctgggattctgatctggagagtcctttttgtaacctctgtgacagacatgagaggtgttgatctgcttagcttcaatctcttcttgaatggacaacaggtgtatgccttgtgaggagctgtgtgcacagctgggaaggtgcatagacatgaagcactgcatcaggcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]