2025-04-20 15:27:12, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XR_011415201 357 bp RNA linear PLN 05-DEC-2024 DEFINITION PREDICTED: Nicotiana tomentosiformis uncharacterized lncRNA (LOC138908792), ncRNA. ACCESSION XR_011415201 VERSION XR_011415201.1 DBLINK BioProject: PRJNA257218 KEYWORDS RefSeq. SOURCE Nicotiana tomentosiformis ORGANISM Nicotiana tomentosiformis Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; asterids; lamiids; Solanales; Solanaceae; Nicotianoideae; Nicotianeae; Nicotiana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_090814) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_000390325.3-RS_2024_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/03/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..357 /organism="Nicotiana tomentosiformis" /mol_type="transcribed RNA" /bio_material="USDA:TW 142" /db_xref="taxon:4098" /chromosome="3" /tissue_type="leaf" gene 1..357 /gene="LOC138908792" /note="uncharacterized LOC138908792; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:138908792" ncRNA 1..357 /ncRNA_class="lncRNA" /gene="LOC138908792" /product="uncharacterized lncRNA" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:138908792" ORIGIN
gccttcacatgcattaaaaagagaaaatttaaagttcgaaacctttgaagatctagaaagcaaagttctaaaaaagaaacaaaagaaaaaaggggaaatgttatttcaaggaaaaaatttgaaatcaacttgatggcttgcgagttttgagtaccaatctcttcttgggtttctaaaaattgcggaatttgaaaatctattgttgttgtattcatgtattagcttagctccactctctcttcttcttagccttatttagcctcacagctttgtttttaaaatactaggtatgtacacttccagttctttgattgttgctagttcgaatgaatgaaatattgatttgttttggctcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]