2024-11-19 20:35:34, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XR_008332942 394 bp RNA linear VRT 26-FEB-2023 DEFINITION PREDICTED: Podarcis raffonei uncharacterized LOC128424167 (LOC128424167), ncRNA. ACCESSION XR_008332942 VERSION XR_008332942.1 DBLINK BioProject: PRJNA928705 KEYWORDS RefSeq. SOURCE Podarcis raffonei (Aeolian wall lizard) ORGANISM Podarcis raffonei Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata; Laterata; Lacertibaenia; Lacertidae; Podarcis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_070613) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_027172205.1-RS_2023_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/25/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..394 /organism="Podarcis raffonei" /mol_type="transcribed RNA" /isolate="rPodRaf1" /specimen_voucher="LC15" /db_xref="taxon:65483" /chromosome="12" /sex="female" /tissue_type="blood" /dev_stage="adult" /geo_loc_name="Italy: Stromboli Island" /lat_lon="38.788175 N 15.229709 E" /collection_date="2020-07-01" /collected_by="Claudio Ciofi" gene 1..394 /gene="LOC128424167" /note="uncharacterized LOC128424167; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:128424167" ncRNA 1..394 /ncRNA_class="lncRNA" /gene="LOC128424167" /product="uncharacterized LOC128424167" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:128424167" ORIGIN
ggtggggagagaaggagactctcctgagggcaacagtgagagaagggaacttgccagtggcccatctagtcctggatcctgttctcacagtggccaacaggcatcaatttacacttatttacattgtttatgttgaattgcacttgccattttattacccattcactcaggttggagagcttgttttcacaatctcttcttgtttgaatgaccctgaacaatttagcatcatcggcaaacttcactgctcacccctaattctcaattgtttttgaacaagttaaatagcagaggtctcagtgttgatctttttaaaataaaaaataaaataaggtgttgttaaagttttttcataatacaataagataaaagaaactaaataaaaacaaaaaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]