GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-21 02:01:32, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_068108352            2529 bp    mRNA    linear   VRT 04-SEP-2024
DEFINITION  PREDICTED: Myxine glutinosa protein argonaute-1-like
            (LOC137421869), mRNA.
ACCESSION   XM_068108352
VERSION     XM_068108352.1
DBLINK      BioProject: PRJNA1152620
KEYWORDS    RefSeq.
SOURCE      Myxine glutinosa (Atlantic hagfish)
  ORGANISM  Myxine glutinosa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Cyclostomata;
            Myxini; Myxiniformes; Myxinidae; Myxininae; Myxine.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_090423) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_040869285.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/29/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2529
                     /organism="Myxine glutinosa"
                     /mol_type="mRNA"
                     /isolate="MG_SS"
                     /isolation_source="wild captured"
                     /db_xref="taxon:7769"
                     /chromosome="2"
                     /sex="hermaphrodite"
                     /tissue_type="testes"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Atlantic Ocean, Gulf of Maine"
                     /collection_date="2011-10"
     gene            1..2529
                     /gene="LOC137421869"
                     /note="protein argonaute-1-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 50
                     Proteins"
                     /db_xref="GeneID:137421869"
     CDS             10..2529
                     /gene="LOC137421869"
                     /codon_start=1
                     /product="protein argonaute-1-like"
                     /protein_id="XP_067964453.1"
                     /db_xref="GeneID:137421869"
                     /translation="
MCSILEVFEPPARPSVGVLGSSISLRTNLFQLDIPKGVIHNYDVQVCPEKCPRRLNREVIQHMIKSYKQIFGETIPAYDGFKNLYTATPLPIGCDHVELEVILDGHVWSSRKFLVSLRWVAAVNFRLLHNSLVGQSAPVPRDSMIALDVIMQHLQSMRYTPVGRSFFSESMHHVHPLGFGREIWFGFHQSLRPAMWNVLLNVDVSATAFYKAQPVLDFLCDVLGLSSPFNRAFLTEAQHVTFSREIAGMKVEISHRGQSKRKYRVCSLSHKSADLQTFPLLMANGQRVECSVARYFRDKHKVQLRFPHLPCLHVGHREKHTFLPLEVCNVMAGQNCIRHLTDSQVSVMIRATAHSATDRQEEIAKQMKTLDFKSDPYTREFEIHVCDKMTDVIGRILPVPVLQYGGKTTVRPHRGIWDMRGKQFYSGIEIKVWALVCFSTRRYCSEQCLKSFTDRLQRISKDVGMPVEGQPCLCKYSHTLDNVELLFRHIKEAYAGLQLVLVVLPGKTPVYAEVKRVGDTFLGIATQCIQTKNVTGTSPQILSNLCLKINAKLGGVNNILLPHRCTSVFKQPAIILGGCLLHPQARDERSAIAAVVGSIDVYPSRYCSAIRFQQQGLVYVVDMAPIMRELLVQFYKATHFKPAKIIYYRKGVAEGQVPKVLYQELLSIREACIGLEEGYKPGITFIAVQKCHHTRLFCSNKAEHVGKSGNIPAGTIVDMKITHPTQFDFYLCSHLGIQGTSRPSHYHVLWDDNCFTADDLQLLTYHLCHTYVRCTRSVSIPAPTYYAQLVAFRARCYLMDKKNNDDSNQVKGQGNGRGLSELVKNAQLHKDTLRTMYFA"
     misc_feature    244..462
                     /gene="LOC137421869"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    490..642
                     /gene="LOC137421869"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    643..999
                     /gene="LOC137421869"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(796..798,841..843,883..885,895..897,949..951,
                     970..972,976..978)
                     /gene="LOC137421869"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1135..2403
                     /gene="LOC137421869"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1540..1542,1552..1554,1588..1599,1606..1608,
                     1630..1632,1639..1641,1651..1653,1663..1665)
                     /gene="LOC137421869"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1744..1746,1750..1752,1957..1959,2371..2373)
                     /gene="LOC137421869"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gcgcgagacatgtgttcaatcttggaggtgttcgagcccccggcaagaccgagtgtgggtgtcctcggaagtagcatcagtctgcggacgaacctcttccagctggacatccccaaaggcgtcatccacaactatgacgtgcaagtctgtcccgaaaagtgtccacggagactcaacagagaggtcatccagcacatgatcaagtcctacaagcagatatttggcgagacaattcccgcctacgacggattcaaaaacctctacactgccacaccgctgcccattggatgtgaccatgtcgagctggaggtcatcttggatgggcacgtttggagtagtcgtaagttcttggtttctttgcgttgggttgctgccgtcaactttcgcctcctgcacaactctttggtcgggcagagtgctccggtgccccgtgactcgatgatcgctctcgatgtgataatgcaacatctgcaatcgatgaggtacacacctgtggggagatcatttttctctgaatccatgcatcatgtccacccgctgggatttggtcgagagatctggttcggcttccatcagtcgttacgaccagcgatgtggaacgtcctgctcaatgtcgatgtatcggctacagctttctacaaagcacaaccggtgttggactttctttgtgacgttcttggtctgtcatctccatttaatcgggcattcctcacagaagctcagcatgtcaccttcagcagggagattgcaggaatgaaggtggaaatttcacatcgtggacagtctaagcgcaaatatcgagtgtgcagcctttcccacaaatctgcagacctccaaacgttccctctgctaatggccaacggacaacgagtggagtgctcggtcgcgcgttacttccgtgacaagcacaaggtgcagctgcggttcccacacctgccctgcttgcatgttggccacagggaaaagcacactttcctcccactcgaggtgtgcaacgtgatggctggccaaaactgcattcgtcatctcaccgacagccaggtttctgtgatgatccgtgcgaccgctcactcggcgactgataggcaggaggagattgccaagcagatgaagaccctcgatttcaagtcggatccttacacaagggagtttgagattcatgtatgtgacaagatgactgacgtgatcggccgcatccttccagtacctgtgcttcaatatggaggcaagaccacagtgaggccccacagaggcatttgggacatgcgtggtaaacagttctacagtggcattgagatcaaagtgtgggccctggtttgcttctctacacgaagatactgcagtgagcaatgtctgaagagcttcacagatcggctgcagaggatctcaaaggatgtagggatgcctgtcgaaggtcagccatgcttgtgcaagtactcgcataccctcgataacgtggagcttctcttccgacacatcaaggaggcatatgccggcttacagcttgtccttgtggttcttccaggaaagacacctgtatacgccgaggtgaaacgtgtgggggacacgtttttgggaattgcgacacagtgcatccagacgaagaacgtgacaggtacatcacctcagattctgtcgaacctctgtctgaagatcaatgctaaactcgggggagtcaacaacattctgcttccacatcggtgcacatcggtgttcaaacagcccgcgatcatccttggaggatgtctattgcacccacaagccagagacgagcgatctgccattgccgcagtggtgggcagcatagatgtgtacccgagccgttactgcagtgcaattcgatttcagcaacagggactggtctatgtcgtggatatggcaccgatcatgcgtgagcttctcgtgcagttctacaaggcaacacacttcaaaccagcaaagatcatttattaccgcaaaggcgtggctgaagggcaggtaccaaaggttctctaccaagagctcctgtccatccgtgaagcgtgcattggtctggaggagggctacaagccaggcatcaccttcatcgctgtgcagaaatgccaccacacacgtctcttctgctcgaacaaggctgagcatgttgggaagagcggaaacattccagctggaactattgtcgatatgaaaatcactcaccccacgcaattcgatttctacctgtgtagccatttgggcatccagggaacgagccgcccatcacactaccatgtactctgggatgacaactgctttacagcagatgacctgcagctgctcacataccatctgtgccatacttatgtgcgttgcacacgctcagtttccatccctgcgcctacctactacgcacagcttgtggcctttcgtgctcgctgctacctcatggataaaaaaaacaatgacgatagcaaccaggtcaaaggtcaaggcaatggaagaggcttgagcgagcttgtgaagaatgcccaactacataaagacactttaagaacaatgtacttcgcctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]