GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-19 20:23:21, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_067996725            1171 bp    mRNA    linear   VRT 29-AUG-2024
DEFINITION  PREDICTED: Heptranchias perlo vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_067996725
VERSION     XM_067996725.1
DBLINK      BioProject: PRJNA1152544
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Heptranchias perlo (sharpnose sevengill shark)
  ORGANISM  Heptranchias perlo
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Chondrichthyes;
            Elasmobranchii; Squalomorphii; Hexanchiformes; Hexanchidae;
            Heptranchias.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_090339) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_035084215.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/27/2024
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 22% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1171
                     /organism="Heptranchias perlo"
                     /mol_type="mRNA"
                     /isolate="sHepPer1"
                     /db_xref="taxon:212740"
                     /chromosome="15"
                     /sex="female"
                     /tissue_type="spleen, liver"
                     /dev_stage="adult"
                     /geo_loc_name="Japan: Okinawa Island"
                     /lat_lon="26.5000 N 127.9333 E"
                     /collection_date="2002-11-08"
     gene            1..1171
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:137332789"
     CDS             1..1086
                     /gene="vimr2"
                     /codon_start=1
                     /product="type III intermediate filament"
                     /protein_id="XP_067852826.1"
                     /db_xref="GeneID:137332789"
                     /translation="
MHGNEQAINPSESGYCGLTPFGFRTLDIDTPMEDYLDDEEVDFQSVSAVNKRYLSECRKDQSQIAALNDRLVQFIERGRSLEEENEIFEQQIEEIWARQEQFVGAGQILRQEAPALSAIAEKLRKEKDEIIAQTNVLRKDLDVLRWKYDETVKKQMQAEEEREELAQEIDVTTGECLALKEQINILENELALMGNSHEQMKKRSKLVDENLWLALEFPSPNMSTAALDIGAYYGKLASSIQFEGRTSGLSPDSTQAQRNVNKGDDSHIKIPELEKELEALKVRNMELNTEIEEREITNEEEIAFNEEQIHELGKKLHLLNEDIKTHLVEYEELLTAKRALDIEITAYRGFIEEEDERLCHL"
     polyA_site      1171
                     /gene="vimr2"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
atgcatggtaacgagcaagctataaatccatcggaatctggatattgtggactgacaccatttggattcaggacccttgacattgatacaccaatggaagattacctggatgatgaagaagtggacttccaaagtgtgagtgcagttaacaagaggtaccttagtgagtgtcggaaggaccagagtcagatagcagcgctcaacgatcgccttgtccaattcattgagcgtggacgctctctggaagaagagaatgagatttttgaacaacaaattgaagaaatttgggcaaggcaggagcagtttgttggtgctggacaaattctaaggcaggaagcccctgccctgagtgcaatagcggagaaactgagaaaagaaaaggatgagataattgctcagaccaatgtactcaggaaagatcttgacgttctgagatggaaatatgatgaaactgtgaaaaagcagatgcaggcagaagaggagcgggaggaattggcacaggaaattgatgtaaccactggtgaatgcctggctttaaaagaacagatcaacattttggagaatgaattggctttgatggggaattctcacgaacagatgaagaaacgctccaaactggtagatgagaatctctggttagctttggagttcccatctcctaacatgagtacagctgctctggacattggggcttactatggcaagcttgcatccagtatacagtttgagggacgaacatctggcttgagcccagattccacacaggcacagagaaatgtcaataaaggtgacgacagccacataaagattcctgaattagaaaaagaactagaggctctcaaagtgagaaacatggaacttaatactgagattgaagaaagagaaataacaaatgaagaggaaattgcattcaatgaggaacagattcatgagttgggaaaaaaactgcatctgcttaatgaggatataaagacacatttggttgagtatgaggagttgctgactgctaaaagggctcttgatattgaaataacagcttacaggggattcatcgaagaagaagatgaaagactttgtcatctttagaaggatgcaactacaaaattacatgtataagatgatgattttttccaaactggtctacaataaattttcactttcaatgtctaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]