2025-10-16 03:10:20, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_046846099 975 bp mRNA linear VRT 18-FEB-2022 DEFINITION PREDICTED: Silurus meridionalis vimentin (vim), partial mRNA. ACCESSION XM_046846099 VERSION XM_046846099.1 DBLINK BioProject: PRJNA807317 KEYWORDS RefSeq. SOURCE Silurus meridionalis (Silurus soldatovi meridionalis) ORGANISM Silurus meridionalis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes; Siluridae; Silurus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060887) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Silurus meridionalis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..975 /organism="Silurus meridionalis" /mol_type="mRNA" /isolate="SWU-2019-XX" /db_xref="taxon:175797" /chromosome="4" /sex="female" /tissue_type="muscle" /dev_stage="adult" gene <1..975 /gene="vim" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 20 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 15 samples with support for all annotated introns" /db_xref="GeneID:124383795" CDS <1..603 /gene="vim" /codon_start=1 /product="vimentin" /protein_id="XP_046702055.1" /db_xref="GeneID:124383795" /translation="
FFALRDVRLQYESLANKNIHEAEEWYKSKFADLSEAAARNMEAIRHTKQDANEYRRQVQALTCEVDSLKGTNESLERQMAELEDTFAMESSNYQDTITHLEEEIRNMKDEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRITTPLPNFSTFNLRESMIETKPLIENLSKKVLIKTIETRDGHVINESTQPHEDLE"
misc_feature <7..435 /gene="vim" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:459643" polyA_site 975 /gene="vim" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
ttctttgcactgcgggatgtccgccttcaatatgagagtctggccaacaagaacatccatgaggctgaggaatggtacaaatccaagtttgcagatttgtctgaggctgctgctcgtaacatggaggccatccgtcatactaagcaggatgcaaatgaatatcgccgccaggtccaggctttaacatgtgaggtggattcgcttaaaggcactaatgagtctctagagcgtcaaatggcggaactggaggacacctttgccatggagtcatctaattaccaggacaccatcacccatctggaagaagaaatccgcaacatgaaggatgagatggctcgtcacttgcgtgagtaccaggacttgctgaatgtcaaaatggccctggacattgagattgctacctacaggaagcttctggagggagaggagagcaggatcaccacaccattacctaatttttctacatttaatctgagagaatccatgatagaaaccaaaccactcattgagaacctgtccaagaaagtgttgattaaaaccatagagacaagagatggtcatgtgattaacgagtccactcagcctcatgaagacctggaatgaactgcatgcaaaacctttaaaagaaatgctcactgagaaggcgagcgctgtagcgggaggagatatatcagtgtgatatttctgtttctgtgacactaaatcagctttaatgtgcctttttgccactcgagacagatcttcagatagagatgtgtcttaagtagaatagggtttgtaggccagtgaaaaccagctctatacagtatttctgttttcctaaactactatagtttacactctgcaagttggaccacagcaataatcttagcaacattgattttttttgttttcggtcagcttgcagcttgaccaacatgaaatgatgtcttcaaaatcaaacaaacaaataaaatcaacacacctttatgaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]