LOCUS       XM_037264743            1775 bp    mRNA    linear   VRT 08-NOV-2020
DEFINITION  PREDICTED: Syngnathus acus testis and ovary specific PAZ domain
            containing 1 (topaz1), mRNA.
ACCESSION   XM_037264743
VERSION     XM_037264743.1
DBLINK      BioProject: PRJNA673235
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Syngnathus acus (greater pipefish)
  ORGANISM  Syngnathus acus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei;
            Syngnathidae; Syngnathus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051096.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Syngnathus acus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 8% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1775
                     /organism="Syngnathus acus"
                     /mol_type="mRNA"
                     /db_xref="taxon:161584"
                     /chromosome="11"
     gene            1..1775
                     /gene="topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 92% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:119130810"
     CDS             79..1626
                     /gene="topaz1"
                     /codon_start=1
                     /product="protein TOPAZ1"
                     /protein_id="XP_037120638.1"
                     /db_xref="GeneID:119130810"
                     /translation="

MPVFLSLLWAHLKAGIVPDVLSVLSVSLAHKIVPTHEFLLALFTFVREKSFTSVVPRLLLLTYKMASERLMLSLDCFDVVKNTPEFQKLIHSDASANLRFYMTSSVPVSDSLNLACVMVEMELCVKQADWCCLAKAFSCICTPHQHPSQLERISGYVAVALLSETKDKMSVPFAAFAETICPNGVPDCLLMGFTGRIGVSLMLRYHKTQQWAKGRKVVEVLTQFKINYSMQKGLFENENGQSRCHLITLATEIFLLSGSLEGALQTLRENKWFVSCNMWPCEHPDLENRSRVLVHLAEKASQRDALEVLCNLPGIQEPNDQVDISRYTPLFNAHLKVCVDRLMLSVAADSVDLMLSQKVPVEDAVLQALLHKLGKQNLWLRARKIFSHSQTAGYYPAVSAPAGFMALTVPSRLGEVELALTFEMLITVNASVILPISEKTPATLSITLKRIQESESEYLSAGSRLLSAALIPQPKLEVHYTAVNSSQEQVFTLSVASAQRWLRSNHMWANDVWTS"

     misc_feature    439..957
                     /gene="topaz1"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:464250"
ORIGIN      

tgtccccgttttgttgtttttccaggagctttgttcataaactactaccaggacaatcccccgggattatttttctccatgcctgtctttctctcactcctctgggctcatctgaaagcaggcatcgtgcctgatgttctttcagtgctcagtgtcagcttggctcacaagatcgtgcctactcatgaattcctgctcgcccttttcacctttgtaagagagaaaagcttcacaagcgttgtccctcgcctcctgctgctaacttacaagatggccagtgaacgtttaatgctgagcttggattgcttcgatgttgttaaaaacactcctgaattccagaagctgatacattcagatgcgtctgccaatcttagattttatatgaccagcagtgtgcccgtttcagactccttgaacttggcctgtgttatggtggagatggagctttgtgttaagcaagcggactggtgctgtctggcgaaagcctttagctgcatttgcacaccccaccaacatcccagccaactggagcgcatcagcggctacgtcgctgtcgctcttctgtcggagaccaaagacaagatgtcggtgccgtttgcggctttcgctgagacaatttgccccaacggagttccagactgcctgttgatgggtttcactggccgaattggagtctctctcatgctaagataccataaaactcaacagtgggccaagggtcggaaggtagtggaggtgctgacccaattcaagatcaactactccatgcagaagggtttgtttgagaatgagaacggtcagtcacgctgccacctgatcaccttggcaacagagatcttcctcctcagtggcagcctggaaggagccctccaaactctccgagagaacaaatggtttgtgagttgcaatatgtggccgtgtgagcatccggacttggagaatagaagccgtgtgctcgtccatctggctgagaaagcctcgcaaagagacgccttggaggtcttgtgtaatctcccaggaatacaagaacccaatgatcaggttgatatctccaggtacacccccctgtttaatgctcacctgaaagtgtgcgtggacagactaatgctttccgtagctgcggactcggtggacttgatgctttctcaaaaggtaccagtagaggatgctgtgctgcaggcgcttttgcacaagctggggaaacaaaacctctggctacgtgcgcgcaagatcttcagtcactctcaaaccgctggctattacccagccgtatcggcccccgctgggttcatggcgctgactgttcctagtcgactgggggaggtggaactcgcgctcacgtttgagatgttaattactgtcaatgcttcagtcattctccctatttctgagaagacacccgccaccctcagcatcaccctaaaaaggattcaagagagcgagagcgagtacctctcagccgggagccgtctgctctcagcggcgctcatcccccaacccaaactggaggtccactatactgctgtgaactcctcacaagaacaagtcttcacgcttagcgttgcctcggcccaacgctggctgcgaagcaatcatatgtgggcgaacgacgtgtggactagttagtttcttaaggaagtttaaagagagttaaaaaaatggttaaagactagagtaggtgattgtattagtgatggataattattgtacgttcaaatactgttactgtatatttttgttcagtgtttttattaaatgttctcaatgttctgtta

//