LOCUS       XM_020720308            2704 bp    mRNA    linear   PLN 10-APR-2017
DEFINITION  PREDICTED: Phalaenopsis equestris protein argonaute MEL1-like
            (LOC110021710), mRNA.
ACCESSION   XM_020720308
VERSION     XM_020720308.1
DBLINK      BioProject: PRJNA382149
KEYWORDS    RefSeq.
SOURCE      Phalaenopsis equestris
  ORGANISM  Phalaenopsis equestris
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Asparagales; Orchidaceae;
            Epidendroideae; Vandeae; Aeridinae; Phalaenopsis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018164582.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Phalaenopsis equestris Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2704
                     /organism="Phalaenopsis equestris"
                     /mol_type="mRNA"
                     /db_xref="taxon:78828"
                     /chromosome="Unknown"
     gene            1..2704
                     /gene="LOC110021710"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 58 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:110021710"
     CDS             370..2625
                     /gene="LOC110021710"
                     /codon_start=1
                     /product="protein argonaute MEL1-like"
                     /protein_id="XP_020575967.1"
                     /db_xref="GeneID:110021710"
                     /translation="

MSRDRTFNISINFVKSLDQYALAQFLSGRQTECPQDIITALDIVLRESASNKYVTVSRSFFSHQFGKMDMSGGLECWRGYFQSIRPTQMGLSLKSLNADTSATPFYKSMSILTFISGFYNERHTLTSLSDRERHEIQKALNGVRVETVHLPNVRRRYRITGITSQSAKELMFTLDETAGTKISVAQYFRTHCKYNLRHDSLPCIKAGSDSKPKYLPLEVCQIVDGQRYVKKLNEVQVSEILKVACTPPTEREGKILELVRKNNYDNDLFAKNFGIGVQPNLITVEARVLQPPRLKYHDSGAEKGCQPFGGKWSMNNKKVFRGGSVDAWACISFSRHYKNIVQDFCHEIVFACNRIGMVFNQNALIIDSGHHQRIENSIHDFVKACAKPLQLLVVILPEAKGAYGRIKKYCDTELGIVTQCCQSKHLNKPNRQYFENLALKINVKAGGCNTVLEDSVRGSIPVISEEPSIIFGADVTHPAPGEDSSSIAAVVASMDWPYVTKYKCLLSAQQRTREIIEKLYTKTDDGVPGGMIRELLFAFHKATGRKPNRIIFYRDGVSEGQFNIVLTSELDAIRRACASIQEGYLPPTTFIVVQKRHHTRLFPENTKMADRSGNILPGTVVDTKICHPNEFDFYLCSHAGIQGTSRPAHYHVLHDENNFTADQLQSLTNNLCYTYARCTRSVSIVPPAYYAHLAAFRARYYIDTGSEYASSQVSGKTRQRTATASAATTSAAPTTGLPAIPENVANVMFYC"

     misc_feature    <376..504
                     /gene="LOC110021710"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    532..690
                     /gene="LOC110021710"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    691..1038
                     /gene="LOC110021710"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(838..840,883..885,919..921,931..933,985..987,
                     1006..1008,1012..1014)
                     /gene="LOC110021710"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1174..2475
                     /gene="LOC110021710"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1576..1578,1588..1590,1624..1635,1642..1644,
                     1666..1668,1675..1677,1687..1689,1699..1701)
                     /gene="LOC110021710"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1789..1791,1795..1797,2032..2034,2443..2445)
                     /gene="LOC110021710"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

tgttgaaaaatctctagaaaatgctgcattattggtctactttttatttaggatccactagaaaattatggtgctaatctctccactaccatccatggaggcgatgcagattttcatgaactactgggtagcaaggaatatagaggctatgtatagaaaaaaatagtagcgtggcaagctaacagctcaggttggggacagatgtgtctcgactatagaaacagagaagtacgatataggcaaagagatgagcaacgcaagctacatctgtatagttaattacacacacaacacaaatccccctacccatctcttccagatcttattccacgtgtgtatttcagtcctaatcatctaggttctctttgcatgagccgggacagaacattcaacatttctatcaattttgtaaaatccttggatcagtatgctctagcacagtttttgagtgggaggcagacggaatgccctcaggatatcataactgctttggatattgtcctccgagagtctgcctcaaataagtacgttacagtttcaagatcattcttttcacatcagtttgggaaaatggatatgtctggaggtttagaatgttggaggggttatttccaaagcattcgaccaacacaaatgggcttatccttgaaatccttgaatgctgatacctctgcaacacctttctacaagtcaatgagcatattaacctttatctcgggtttttataatgaacgacatacgcttacaagtttatctgatagggaacgtcatgagatacaaaaggcgttgaatggagtccgggtggaaacagttcatttaccaaatgtgcgtagacgctatagaatcacaggaattacatcacagtctgctaaagagttgatgttcactcttgatgaaacagcgggaactaaaatatctgtggcccaatactttagaacacattgcaagtataatcttaggcacgattcactaccatgcattaaagccggtagtgatagcaagccaaaatacttgccactagaggtatgccaaattgtggatggacagaggtatgttaagaagttaaatgaagtgcaagttagtgaaatactaaaagtagcttgtacgcctccaactgagagggaggggaaaattttggagctggtcaggaaaaataattatgacaatgatctatttgcaaaaaactttggtattggggttcaacctaatcttatcacagttgaagcacgagtgctacaaccgccaagactgaagtatcacgatagtggcgctgagaagggctgtcaaccctttggggggaaatggagtatgaataataagaaagtgtttcgaggcggtagtgttgatgcttgggcatgcataagcttttctcgtcattataagaatatcgttcaagatttctgccatgagatagtcttcgcgtgcaaccgcattggaatggttttcaatcaaaatgctttgatcatcgattcaggtcaccatcaacgtatagaaaatagcatacatgattttgtgaaagcgtgtgctaagccgcttcaattgctagttgttattcttccagaggctaagggtgcatatggcaggataaaaaaatattgtgatactgagcttggtattgtcactcagtgttgccagtcaaagcacctaaacaagccaaatagacaatactttgaaaatttagctttgaaaatcaatgtgaaggctggtggctgtaatactgttcttgaagattctgtcagaggttcaatccctgtcatatccgaagagccttctattatatttggagctgatgtcacccatccggcccctggagaagactcttcctccattgctgcggtggttgcatctatggattggccctacgtaacaaagtacaaatgtcttttatctgcacaacaacgtacaagagaaattatagagaagctctatacaaagactgacgatggagtgcctgggggaatgataagggagcttctttttgcgttccataaagcgacaggccgtaaaccaaatcgcatcatattctacagggatggtgttagtgaaggccaattcaacattgtgcttacatcggaactggatgctattcgaagagcttgtgcctcaatacaagaaggatatcttccaccaactacatttatagtggtgcagaagagacaccatactcgtttatttcctgagaatacaaaaatggctgataggagcgggaacattttgccaggtacggtagtcgatacaaagatttgccatcccaatgagttcgacttctacctttgcagtcatgctggtattcagggcacaagtcgtcccgctcattatcatgttctccatgatgaaaacaattttactgctgatcagttgcagtcgctaaccaataacttatgctacacatatgcccgatgcacgcgctctgtttctattgttcctcctgcatattatgcgcatcttgcagcattccgggctcgatattacatagatacagggtctgaatatgcatcaagtcaagtcagtggaaaaacacgccaacgaactgcaaccgcttcggcagctaccacatcagccgcacccacaactggtctcccagctattccagaaaacgtcgcaaacgtgatgttttactgttagaagatgagcagctcgatgaattaaaaaatatgggagatttgcatgcatatcacaacattttacatatttacgtataaac

//