2025-09-16 17:02:24, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_020539519 1033 bp mRNA linear PLN 20-FEB-2025 DEFINITION PREDICTED: Zea mays protein argonaute 1B (LOC103630173), mRNA. ACCESSION XM_020539519 VERSION XM_020539519.2 DBLINK BioProject: PRJNA655717 KEYWORDS RefSeq. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_050101.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Aug 31, 2020 this sequence version replaced XM_020539519.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_902167145.1-RS_2025_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/14/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1033 /organism="Zea mays" /mol_type="mRNA" /cultivar="B73" /db_xref="taxon:4577" /chromosome="6" gene 1..1033 /gene="LOC103630173" /note="protein argonaute 1B; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 long SRA reads, and 89% coverage of the annotated genomic feature by RNAseq alignments, including 9 samples with support for all annotated introns" /db_xref="GeneID:103630173" CDS 254..850 /gene="LOC103630173" /codon_start=1 /product="protein argonaute 1B" /protein_id="XP_020395108.1" /db_xref="GeneID:103630173" /translation="
MGLSLNIDMSSTAFIEPLPMIDFVAQLLNRDILVRPLSDSDRVKIKKTLRGVKVEVTHRGNMRRKYRISGLTSQATRELSFPVDDRGTVKTVVQYFMETYGFSIQHTTLPCLQVGNQQRPNYLPMEVCKIVEGQRYSKRLNEKQITSLLKVTCQRPQERELDILQDSGSHQVTPPHHDDFADKCLNSSGGATNNNLMS"
misc_feature 302..646 /gene="LOC103630173" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(449..451,494..496,527..529,539..541,593..595, 614..616,620..622) /gene="LOC103630173" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" ORIGIN
agtatttaaggtggtgatcaaatttgcggcccgtgctgatctccaccatctggctatgtttctagctggaaggcaagcagatgcccctcaggaagctcttcaagtgcttgacattgtactacgtgaattgcctaccgcgaggtattctcctgttggtaggtcattttactctcccaacttagggagacgtcaaaaacttggtgagggataggaaagttggcgtggtttttaccaaagcataaggccgacaaagatgggcctttcactgaatattgatatgtcctctactgcatttatcgagcctctccctatgatcgattttgttgctcagcttcttaacagagatatcttagttagaccattatctgattctgatcgcgtgaagattaaaaaaaccctaagaggtgtgaaggttgaggtgactcacaggggaaacatgcgcagaaaatatcgcatttctggcctcacctcacaagcaacaagagagctatcattccctgttgatgatcgtggtactgtgaagactgtggtgcaatacttcatggagacttatggttttagtatccagcacaccactttaccatgcttgcaagtgggcaatcaacaaagaccaaattatctgcctatggaggtttgcaagattgttgaaggacagcgttactcaaagcgactcaatgagaaacaaatcacttctctactgaaagtgacctgccagcgccctcaagagcgtgagctagacatcttacaggattccggctctcatcaagtgactcctccccatcacgatgactttgcggacaaatgtctcaattctagtggtggagctacgaacaacaatctgatgtcctgattgagagcgatagagctaatgtttgaacttgtgtgtttgaacttgtgaactaaaaatgtgaactatagatgtgaacttatgtgaatttgtgaacttatgcatttggacttatgtgaatttgtgaacttatgtatttggacttgtgtgaatttgtgatatgaacatatatccatgtgtttgaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]