2025-10-16 03:19:33, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_019726516 2145 bp mRNA linear MAM 10-JUN-2025 DEFINITION PREDICTED: Rhinolophus sinicus argonaute RISC catalytic component 3 (LOC109444829), transcript variant X7, mRNA. ACCESSION XM_019726516 VERSION XM_019726516.2 DBLINK BioProject: PRJNA1271591 KEYWORDS RefSeq. SOURCE Rhinolophus sinicus (Chinese rufous horseshoe bat) ORGANISM Rhinolophus sinicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera; Rhinolophoidea; Rhinolophidae; Rhinolophinae; Rhinolophus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_133756) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jun 10, 2025 this sequence version replaced XM_019726516.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_036562045.2-RS_2025_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.4 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/03/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2145 /organism="Rhinolophus sinicus" /mol_type="mRNA" /isolate="RSC01" /db_xref="taxon:89399" /sex="male" /tissue_type="muscle" /geo_loc_name="China" /collection_date="2019" /linkage_group="LG06" gene 1..2145 /gene="LOC109444829" /note="argonaute RISC catalytic component 3; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 20 samples with support for all annotated introns" /db_xref="GeneID:109444829" CDS 131..2011 /gene="LOC109444829" /codon_start=1 /product="protein argonaute-3 isoform X5" /protein_id="XP_019582075.1" /db_xref="GeneID:109444829" /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFNADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 131..472 /gene="LOC109444829" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(266..268,311..313,353..355,365..367,419..421, 440..442,446..448) /gene="LOC109444829" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 605..1882 /gene="LOC109444829" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1016..1018,1028..1030,1064..1075,1082..1084, 1106..1108,1115..1117,1127..1129,1139..1141) /gene="LOC109444829" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1220..1222,1226..1228,1436..1438,1850..1852) /gene="LOC109444829" /note="active site" /db_xref="CDD:240015" ORIGIN
cctctggcagcagtgtggagaatagatagaggagaaaaaactaatctgagaagccagttaggaggctttttcaatcactagttcagtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattcgcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacgagaaggcctgccagtcatcaaacctttcctttgcagttagaaaatggccaaactgtggagagaacagtagcacagtatttcagagaaaagtatactcttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaaacatacatacctgccactagaagtctgtaatattgtggcaggacaacgatgtatcaagaagctaacggacaatcagacttccactatgatcaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcaatttaaagttcgggatgaaatggcccatgtaaccggacgcgtacttccagcacctatgctccagtatggaggacggaatcgtacagtagcaacaccaagccatggagtgtgggacatgcgagggaaacaattccacacgggagtggaaatcaaaatgtgggccatagcttgttttgccacccagaggcagtgcagagaagaaatactgaagggtttcacggaccagctgcgtaagatttctaaagatgcggggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacctactctgggctgcagctcattatcgtcattctgccagggaagacgccagtgtatgcggaagtgaaacgtgtaggagatacacttttgggtatggctacacagtgtgttcaagtcaagaacgtaataaaaacatcccctcaaactctctcaaacttgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaaccagtgatctttttgggagcagatgtcactcacccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggatgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgagaacttctcattcaattttataagtcaactcgattcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttaggcaggtattatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagactatcaacctggaataacctacattgtggttcagaagagacatcacactcgattattttgtgctgataggacagaaagggttggaagaagtggcaatatcccagctggaacaacagttgatacagacattacacacccctatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggatgataactgctttaatgcagatgaacttcagctgctaacttaccagctctgccacacttatgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtggcattcagagccagatatcatctcgtagacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaatgtccaaggatgttctcggagaggaagaactgaaagatgaatcgacatacaacctatgtttccagtggagtcagttaggtggtgatgcctgcagccatacagaaaccaacactgtggggaccagggtctgat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]