GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-18 20:55:56, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_019726514            2200 bp    mRNA    linear   MAM 10-JUN-2025
DEFINITION  PREDICTED: Rhinolophus sinicus argonaute RISC catalytic component 3
            (LOC109444829), transcript variant X5, mRNA.
ACCESSION   XM_019726514
VERSION     XM_019726514.2
DBLINK      BioProject: PRJNA1271591
KEYWORDS    RefSeq.
SOURCE      Rhinolophus sinicus (Chinese rufous horseshoe bat)
  ORGANISM  Rhinolophus sinicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera;
            Rhinolophoidea; Rhinolophidae; Rhinolophinae; Rhinolophus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_133756) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 10, 2025 this sequence version replaced XM_019726514.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_036562045.2-RS_2025_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/03/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2200
                     /organism="Rhinolophus sinicus"
                     /mol_type="mRNA"
                     /isolate="RSC01"
                     /db_xref="taxon:89399"
                     /sex="male"
                     /tissue_type="muscle"
                     /geo_loc_name="China"
                     /collection_date="2019"
                     /linkage_group="LG06"
     gene            1..2200
                     /gene="LOC109444829"
                     /note="argonaute RISC catalytic component 3; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 Protein, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 23 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:109444829"
     CDS             186..2066
                     /gene="LOC109444829"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X5"
                     /protein_id="XP_019582073.1"
                     /db_xref="GeneID:109444829"
                     /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFNADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    186..527
                     /gene="LOC109444829"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(321..323,366..368,408..410,420..422,474..476,
                     495..497,501..503)
                     /gene="LOC109444829"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    660..1937
                     /gene="LOC109444829"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1071..1073,1083..1085,1119..1130,1137..1139,
                     1161..1163,1170..1172,1182..1184,1194..1196)
                     /gene="LOC109444829"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1275..1277,1281..1283,1491..1493,1905..1907)
                     /gene="LOC109444829"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atagaggagaaaaaactaatctgagaagccagttaggaggctttttcaatcactagttcaggtttcagtctacatgttacttccttgagaagcagtatttgacacccttcacccccccatccagccatcccccaagtctgatttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattcgcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacgagaaggcctgccagtcatcaaacctttcctttgcagttagaaaatggccaaactgtggagagaacagtagcacagtatttcagagaaaagtatactcttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaaacatacatacctgccactagaagtctgtaatattgtggcaggacaacgatgtatcaagaagctaacggacaatcagacttccactatgatcaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcaatttaaagttcgggatgaaatggcccatgtaaccggacgcgtacttccagcacctatgctccagtatggaggacggaatcgtacagtagcaacaccaagccatggagtgtgggacatgcgagggaaacaattccacacgggagtggaaatcaaaatgtgggccatagcttgttttgccacccagaggcagtgcagagaagaaatactgaagggtttcacggaccagctgcgtaagatttctaaagatgcggggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacctactctgggctgcagctcattatcgtcattctgccagggaagacgccagtgtatgcggaagtgaaacgtgtaggagatacacttttgggtatggctacacagtgtgttcaagtcaagaacgtaataaaaacatcccctcaaactctctcaaacttgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaaccagtgatctttttgggagcagatgtcactcacccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggatgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgagaacttctcattcaattttataagtcaactcgattcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttaggcaggtattatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagactatcaacctggaataacctacattgtggttcagaagagacatcacactcgattattttgtgctgataggacagaaagggttggaagaagtggcaatatcccagctggaacaacagttgatacagacattacacacccctatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggatgataactgctttaatgcagatgaacttcagctgctaacttaccagctctgccacacttatgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtggcattcagagccagatatcatctcgtagacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaatgtccaaggatgttctcggagaggaagaactgaaagatgaatcgacatacaacctatgtttccagtggagtcagttaggtggtgatgcctgcagccatacagaaaccaacactgtggggaccagggtctgat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]