LOCUS       XM_019547741            2491 bp    mRNA    linear   VRT 20-DEC-2016
DEFINITION  PREDICTED: Crocodylus porosus protein argonaute-1 (LOC109318455),
            transcript variant X7, mRNA.
ACCESSION   XM_019547741
VERSION     XM_019547741.1
DBLINK      BioProject: PRJNA357059
KEYWORDS    RefSeq.
SOURCE      Crocodylus porosus (Australian saltwater crocodile)
  ORGANISM  Crocodylus porosus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Crocodylia; Longirostres; Crocodylidae;
            Crocodylus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017728939.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Crocodylus porosus Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2491
                     /organism="Crocodylus porosus"
                     /mol_type="mRNA"
                     /isolate="Cpor-Errol"
                     /db_xref="taxon:8502"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
     gene            1..2491
                     /gene="LOC109318455"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 6 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:109318455"
     CDS             98..2392
                     /gene="LOC109318455"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X6"
                     /protein_id="XP_019403286.1"
                     /db_xref="GeneID:109318455"
                     /translation="

MEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWMAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQTFPLLRPLG"

     misc_feature    197..589
                     /gene="LOC109318455"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    617..769
                     /gene="LOC109318455"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    770..1132
                     /gene="LOC109318455"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(926..928,971..973,1013..1015,1025..1027,1079..1081,
                     1100..1102,1106..1108)
                     /gene="LOC109318455"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1265..2362
                     /gene="LOC109318455"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1676..1678,1688..1690,1724..1735,1742..1744,
                     1766..1768,1775..1777,1787..1789,1799..1801)
                     /gene="LOC109318455"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
ORIGIN      

ggaggctgcccagaggctgcggcggcagcgggaggtgtcggtgcggccgcccccgccccgcgctcagccaggctcggccgctgcccgggtggatgggatggaagcaggaccctcgggagcagctgcgggcgcttacctgccacccttacagcaggtatttcaagcaccacgccggcccgggataggaaccgtcgggaagcccatcaaactcttggccaactactttgaagtggacattcccaagatcgatgtctatcactatgaagtggatatcaaacccgacaaatgtccgcgcagagtcaacagggaggtggtggaatatatggtacaacacttcaaacctcagatcttcggtgaccgcaagccagtatacgatgggaagaaaaacatttacactgtcactgctttgcccattggaaatgaacgggttgactttgaggtaacgattccaggagaaggcaaggacaggatctttaaggtttccataaagtggatggcaatcgtgagctggcggatgctgcatgaagccctagtgagcgggcagatccccgtccctctggaatcggtccaggcactagatgtggccatgcgccatctggcttcaatgaggtacactcctgtgggccgctcctttttctctcctccggaaggttactaccacccccttggtgggggcagggaggtttggtttggattccatcagtccgtcaggcctgccatgtggaagatgatgctcaacattgacgtgtcggcaacggctttctacaaagcccagcctgtgattgagttcatgtgcgaagtgctggacatccggaacattgacgagcagccgaagcccctgacagattcacagagggtgcgcttcactaaggagataaaaggtttgaaagtagaggtgacccactgtggacagatgaagaggaaataccgtgtgtgtaacgttaccaggcgaccagccagtcaccaaacgttccccctgcagctggagagtggccagactgtggagtgcacagtggctcagtacttcaagcagaaatacaacctgcagctgaaatacccccacctaccatgtctgcaggtcggccaggaacagaagcatacgtacctgcccctggaggtgtgtaacattgtggcaggccagcgctgcatcaagaagctaacagacaatcagacgtcaaccatgataaaggcaacagcaaggtctgccccggacaggcaagaggaaatcagccgcctgatgaaaaatgccagttacaacctagatccgtacatacaggagtttgggataaaggtgaaggatgacatgacggaggtgaccgggagggtccttcctgcgccaatcctacagtatggaggacggaaccgggcgatcgccactcccaaccagggcgtgtgggatatgcgcgggaagcagttctacaacggcattgagatcaaagtgtgggccatcgcatgctttgcccctcagaagcagtgtcgagaagaggtgctgaagaacttcacagaccagctgcgcaagatatccaaggatgcggggatgccaatccagggacagccatgcttctgtaaatacgcccagggcgcggacagtgtggagcccatgttccgacacctcaaaaacacctactcagggctccagctcatcattgttatcctaccagggaaaacaccggtgtatgcggaggtaaagcgtgtgggggacacactcctggggatggccacacagtgcgttcaggtcaagaacgtagtgaagacctctccacagaccctctctaatctctgcctcaagatcaatgtcaagttgggtggaatcaacaacatccttgtgcctcatcagcgctcagccgtctttcagcagccagtgatcttcctcggagctgatgtcactcacccgccagcaggagatgggaagaagccttccatcacagctgttgtgggcagcatggatgcccacccaagccgttactgtgccaccgtgcgtgtgcagcgaccgcgacaggagattattgaggacttgtcatacatggtgagggaacttcttatccagttctacaagtccacccgcttcaagcccaccaggatcatcttctatcgggatggggttcctgaggggcagctcccacagattcttcactacgagcttctggcaatccgggatgcctgcatcaaactggaaaaggattatcagcctggcatcacctacatagttgtccagaaacggcaccacacccgccttttctgtgcagacaagaacgagaggattggcaagagtggcaacatcccggcaggaacaactgtggataccaacatcacccacccatttgaattcgacttctacctttgcagtcatgcaggcattcagaccttcccattactacgtcctctgggatgacaaccggtttacagcagatgagctgcagatcctcacgtaccagctctgtcacacctatgtgcgatgcacccgctctgtctccatcccggcaccagcata

//