GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-19 20:24:46, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_019512210            2458 bp    mRNA    linear   VRT 16-DEC-2016
DEFINITION  PREDICTED: Gavialis gangeticus protein argonaute-1 (LOC109294022),
            transcript variant X3, mRNA.
ACCESSION   XM_019512210
VERSION     XM_019512210.1
DBLINK      BioProject: PRJNA357062
KEYWORDS    RefSeq.
SOURCE      Gavialis gangeticus (Gharial)
  ORGANISM  Gavialis gangeticus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Crocodylia; Longirostres; Gavialidae;
            Gavialinae; Gavialis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017729015.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Gavialis gangeticus Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2458
                     /organism="Gavialis gangeticus"
                     /mol_type="mRNA"
                     /isolate="Ggan-Ray"
                     /db_xref="taxon:94835"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
     gene            1..2458
                     /gene="LOC109294022"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 7 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:109294022"
     CDS             65..2359
                     /gene="LOC109294022"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X3"
                     /protein_id="XP_019367755.1"
                     /db_xref="GeneID:109294022"
                     /translation="
MEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWMAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQTFPLLRPLG"
     misc_feature    164..556
                     /gene="LOC109294022"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    584..736
                     /gene="LOC109294022"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    737..1099
                     /gene="LOC109294022"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(893..895,938..940,980..982,992..994,1046..1048,
                     1067..1069,1073..1075)
                     /gene="LOC109294022"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1232..2329
                     /gene="LOC109294022"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1643..1645,1655..1657,1691..1702,1709..1711,
                     1733..1735,1742..1744,1754..1756,1766..1768)
                     /gene="LOC109294022"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
ORIGIN      
ggtgtcggtgcggccgtctccgccccgcgctcagccaggctcggccgctgcccgggtggatgggatggaagcaggaccctcgggagcagctgcgggcgcttacctgccacccttacagcaggtatttcaagcaccacgccggcccgggataggaactgtcgggaagcccatcaaactcttggccaactactttgaagtggacattcccaagatcgatgtctatcactatgaagtggatatcaaacccgacaaatgtccgcgcagagtcaacagggaggtggtggaatatatggtacaacacttcaaacctcagatcttcggtgaccgcaagccagtatacgatgggaagaaaaacatttacactgtcactgctttgcccattggaaatgaacgggttgactttgaggtaacaattccgggagaaggcaaggacaggatcttcaaggtttccataaagtggatggcaatcgtgagctggcggatgctgcatgaagccctagtgagcgggcagatccccgtccctctggaatcggtccaggcactggatgtggccatgcgccatctggcttcaatgaggtacactcctgtgggccgctcctttttctctcctccggaaggttactaccacccccttggtgggggcagggaggtttggtttggattccatcagtccgtcaggcctgccatgtggaagatgatgctcaacattgatgtgtcggcaacggctttctacaaagcccagcctgtgattgagttcatgtgcgaagtactggacatccggaacattgacgagcagccgaagcccctgacagattcacagagggtgcgcttcactaaggagatcaaaggtttgaaagtagaggtgacccactgtggacagatgaagaggaaataccgtgtgtgtaacgttaccaggcgaccagccagtcaccaaacgttccccctgcagctggagagtggccagacggtggagtgcacagtggctcagtacttcaagcagaaatacaacctgcagctgaaatacccccacctaccctgtctgcaggttggccaggaacagaagcacacatatctgcccctggaggtgtgtaacattgtggcaggccagcgctgcatcaagaagctaacagacaatcagacgtcaaccatgataaaggcaacagcaaggtctgccccagacaggcaagaggaaattagccgcctgatgaaaaatgccagttacaacctagatccgtacatacaggagtttgggataaaggtgaaggatgacatgacggaggtgaccgggagggtccttcctgcgccaatcctacagtatggaggacggaaccgggcgatcgccactcccaaccagggcgtgtgggatatgcgcgggaagcagttctacaacggcattgagatcaaagtgtgggccatcgcatgctttgcccctcagaagcagtgtcgagaagaggtgctgaagaacttcacagaccagctgcgcaagatatccaaggatgcagggatgccaatccagggacagccatgcttctgtaaatatgcccagggcgcagacagtgtggagcccatgttccgacacctcaaaaacacctactcagggctccagctcatcattgtcatcctaccagggaaaacaccggtgtatgcggaggtaaagcgtgtgggggacacactcctggggatggccacacagtgcgttcaggtcaagaacgtagtgaagacctctccacagaccctctccaatctctgcctcaagatcaatgtcaagttgggtggaatcaacaacatccttgtgcctcatcagcgctcagccgtctttcagcagccagtgatcttcctcggagctgatgtcactcacccaccagcaggagatgggaagaagccttccatcacagccgttgtgggcagcatggatgcccacccaagccgttactgtgccacagtgcgtgtgcagcgaccgcgacaggagattattgaggacttgtcatacatggtgagggaacttcttatccagttctacaagtccacccgcttcaagcccaccaggatcatcttctatcgggacggggttcccgaggggcagctcccacagattcttcactacgagcttctggcaatccgggatgcctgcatcaaactggaaaaggattatcagcctggcatcacctacatagttgtccagaaacggcaccacacccgccttttctgtgcagacaagaacgagaggattggcaagagtggcaacatcccggcaggaacaactgtggataccaacatcacccacccatttgaattcgacttctacctttgcagtcatgcaggcattcagaccttcccattactacgtcctctgggatgacaaccggtttacagcagatgagctgcagatcctcacgtaccagctctgtcacacctatgtgcggtgcacccgctctgtctccatcccggcaccagcata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]