2025-09-16 17:00:39, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_009082080 2428 bp mRNA linear VRT 05-SEP-2014 DEFINITION PREDICTED: Acanthisitta chloris argonaute RISC catalytic component 4 (AGO4), partial mRNA. ACCESSION XM_009082080 VERSION XM_009082080.1 DBLINK BioProject: PRJNA253841 KEYWORDS RefSeq. SOURCE Acanthisitta chloris (rifleman) ORGANISM Acanthisitta chloris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Passeriformes; Acanthisittidae; Acanthisitta. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_008691020.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Acanthisitta chloris Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on the 3' end. FEATURES Location/Qualifiers source 1..2428 /organism="Acanthisitta chloris" /mol_type="mRNA" /isolate="BGI_N310" /db_xref="taxon:57068" /chromosome="Unknown" /sex="female" /geo_loc_name="New Zealand" gene 1..>2428 /gene="AGO4" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 24 Proteins" /db_xref="GeneID:103809253" CDS 182..>2428 /gene="AGO4" /codon_start=1 /product="protein argonaute-4" /protein_id="XP_009080328.1" /db_xref="GeneID:103809253" /translation="
MVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSIQWVSVVSLQMLLEALAGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNISEQSKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKLTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQETSQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRAR"
misc_feature 191..445 /gene="AGO4" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 476..628 /gene="AGO4" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 629..991 /gene="AGO4" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(785..787,830..832,872..874,884..886,938..940, 959..961,965..967) /gene="AGO4" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1130..2428 /gene="AGO4" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1541..1543,1553..1555,1589..1600,1607..1609, 1631..1633,1640..1642,1652..1654,1664..1666) /gene="AGO4" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1745..1747,1751..1753,1991..1993,2405..2407) /gene="AGO4" /note="active site" /db_xref="CDD:240015" ORIGIN
gcccccagcgagtctcttccagccgccgcgccgccccggcctgggcaccgtggggaaacccattcgcctcctggccaaccacttccaggtgcagatcccgaagattgatgtgtatcactatgatgtggatatcaaaccagagaaacggccccgaagagtcaacagggaggtggtggataccatggtgaggcacttcaagatgcagatatttggggatcggcagcccgggtatgatgggaagaggaacatgtacacggcacacccgttacccatcggcagggacagggtggatatggaggtgacacttccaggagaggggaaggaccagacgttcaaggtttccattcagtgggtgtcggtcgtcagccttcagatgctgctggaagctctggcaggacacttgaatgaagttcctgaagattctgtacaggcactggatgtgatcacacggcaccttccctccatgaggtacacccctgtgggtcgctccttcttctccccccctgaaggctactaccaccccctgggagggggcagggaggtctggttcgggttccaccagtcggtccgacctgccatgtggaacatgatgctcaacatcgacgtgtcagcaactgctttctatcgtgcccagcctatcattgagttcatgtgtgaggtcttggacatccagaacatcagtgagcagagcaaacctctgacagactcccagcgcgtcaagtttaccaaagaaatcagaggtctcaaggtggaggttacccactgtggccagatgaagaggaaataccgagtttgcaacgttacacggcgaccggcgagtcaccagacgttccctctgcagctggagaatgggcaggccatggagtgcacggtggctcagtacttcaagcagaagtacagcctgcagctgaaataccctcacctgccctgcctgcaggtggggcaggagcagaagcacacgtacctgcccctggaggtgtgtaacatcgtggcaggccagagatgcatcaagaagctcacggacaatcagacttcgaccatgatcaaagcgacagccaggtctgccccggacaggcaggaggagatcagcagactggtgaagagcaacagcatggtgggtggccctgacccgtacctgaaggagtttggcattgttgtccataacgaaatgacagagctgacaggcagagtgctgccagccccaatgctgcagtatggaggcaggaacaagactgtggccacaccaaaccaaggcgtgtgggacatgagggggaaacagttctacgccggcattgagattaaagtctgggctgtggcctgttttgctcctcagaaacaatgcagggaagacttgctgaagagtttcaccgaccaactgcgcaagatctccaaggacgctgggatgcccatccagggccagccctgcttctgcaagtatgcccaaggggcagacagcgtggagcccatgttcaagcacctgaagctgacctacgtggggctgcagctcatcgtggtgatcctgcctgggaagacacccgtgtacgctgaagtcaagcgggttggagacactcttctaggcatggccacacagtgtgtgcaggtaaagaatgtggtcaaaacctcaccacagacactgtccaacctgtgtctgaagatcaacgcgaagcttggagggatcaacaacgtgctggtacctcatcaaaggccctcggtgttccagcagccagtgatcttcctgggggcagacgtgacccaccctccagccggggacgggaagaagccgtcgatcgcggccgtggtgggcagcatggacgggcaccccagccgctactgcgccacggtgcgcgtgcagacctcgcgccaggagacctcccaggagctgctctacagccaggaggtcatccaggacctcaccaacatggtgagggagctcctgatccagttctacaaatccacacgcttcaagcccaccaggatcatctactacagagggggagtgtcggaaggacagatgaaacaggtggcctggcccgagctgatcgccatcaggaaggcctgcatcagtttggaggaggactacagaccaggaataacctacatcgtggtgcagaagaggcaccacaccaggctcttctgtgctgacaaaaccgagagggtgggtaagagcggcaacgtaccagcagggactactgtggacagcaccatcacacatccctcggaatttgacttttacctctgtagccatgcaggaattcagggaaccagccgtccctcccactaccaggtgttgtgggatgacaactgcttcacggcggacgagctgcagctgctgacctaccagctgtgccacacctacgtgcgctgcacgcgctccgtctccatccccgcgcccgcctactacgctcacctggtggccttcagggccagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]