GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-20 15:37:42, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NR_197270               1286 bp    RNA     linear   ROD 25-JUL-2024
DEFINITION  Rattus norvegicus glyceraldehyde-3-phosphate dehydrogenase,
            pseudogene 119 (Gapdh-ps119), non-coding RNA.
ACCESSION   NR_197270
VERSION     NR_197270.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1286)
  AUTHORS   Kornberg,M.D., Sen,N., Hara,M.R., Juluri,K.R., Nguyen,J.V.,
            Snowman,A.M., Law,L., Hester,L.D. and Snyder,S.H.
  TITLE     GAPDH mediates nitrosylation of nuclear proteins
  JOURNAL   Nat Cell Biol 12 (11), 1094-1100 (2010)
   PUBMED   20972425
REFERENCE   2  (bases 1 to 1286)
  AUTHORS   Baba,T., Kobayashi,H., Kawasaki,H., Mineki,R., Naito,H. and
            Ohmori,D.
  TITLE     Glyceraldehyde-3-phosphate dehydrogenase interacts with
            phosphorylated Akt resulting from increased blood glucose in rat
            cardiac muscle
  JOURNAL   FEBS Lett 584 (13), 2796-2800 (2010)
   PUBMED   20488185
REFERENCE   3  (bases 1 to 1286)
  AUTHORS   Sen,N., Hara,M.R., Ahmad,A.S., Cascio,M.B., Kamiya,A., Ehmsen,J.T.,
            Agrawal,N., Hester,L., Dore,S., Snyder,S.H. and Sawa,A.
  TITLE     GOSPEL: a neuroprotective protein that binds to GAPDH upon
            S-nitrosylation
  JOURNAL   Neuron 63 (1), 81-91 (2009)
   PUBMED   19607794
  REMARK    Erratum:[Neuron. 2009 Sep 10;63(5):709. Aggrawal, Nishant
            [corrected to Agrawal, Nishant]]
REFERENCE   4  (bases 1 to 1286)
  AUTHORS   Foster,L.J., Rudich,A., Talior,I., Patel,N., Huang,X.,
            Furtado,L.M., Bilan,P.J., Mann,M. and Klip,A.
  TITLE     Insulin-dependent interactions of proteins with GLUT4 revealed
            through stable isotope labeling by amino acids in cell culture
            (SILAC)
  JOURNAL   J Proteome Res 5 (1), 64-75 (2006)
   PUBMED   16396496
REFERENCE   5  (bases 1 to 1286)
  AUTHORS   Hara,M.R., Agrawal,N., Kim,S.F., Cascio,M.B., Fujimuro,M.,
            Ozeki,Y., Takahashi,M., Cheah,J.H., Tankou,S.K., Hester,L.D.,
            Ferris,C.D., Hayward,S.D., Snyder,S.H. and Sawa,A.
  TITLE     S-nitrosylated GAPDH initiates apoptotic cell death by nuclear
            translocation following Siah1 binding
  JOURNAL   Nat Cell Biol 7 (7), 665-674 (2005)
   PUBMED   15951807
REFERENCE   6  (bases 1 to 1286)
  AUTHORS   Ishida,A., Tada,Y., Nimura,T., Sueyoshi,N., Katoh,T., Takeuchi,M.,
            Fujisawa,H., Taniguchi,T. and Kameshita,I.
  TITLE     Identification of major Ca(2+)/calmodulin-dependent protein kinase
            phosphatase-binding proteins in brain: biochemical analysis of the
            interaction
  JOURNAL   Arch Biochem Biophys 435 (1), 134-146 (2005)
   PUBMED   15680915
REFERENCE   7  (bases 1 to 1286)
  AUTHORS   Andrade,J., Pearce,S.T., Zhao,H. and Barroso,M.
  TITLE     Interactions among p22, glyceraldehyde-3-phosphate dehydrogenase
            and microtubules
  JOURNAL   Biochem J 384 (Pt 2), 327-336 (2004)
   PUBMED   15312048
REFERENCE   8  (bases 1 to 1286)
  AUTHORS   Wu,K., Aoki,C., Elste,A., Rogalski-Wilk,A.A. and Siekevitz,P.
  TITLE     The synthesis of ATP by glycolytic enzymes in the postsynaptic
            density and the effect of endogenously generated nitric oxide
  JOURNAL   Proc Natl Acad Sci U S A 94 (24), 13273-13278 (1997)
   PUBMED   9371836
  REMARK    Erratum:[Proc Natl Acad Sci U S A 1998 Mar 3;95(5):2714]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000005.1.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR26360176.1134614.1,
                                        SRR23984936.903615.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1286              JAXUCZ010000005.1  116787571-116788856
FEATURES             Location/Qualifiers
     source          1..1286
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="5"
                     /map="5"
     gene            1..1286
                     /gene="Gapdh-ps119"
                     /note="glyceraldehyde-3-phosphate dehydrogenase,
                     pseudogene 119"
                     /pseudo
                     /db_xref="GeneID:134486952"
                     /db_xref="RGD:401988152"
     misc_RNA        1..1286
                     /gene="Gapdh-ps119"
                     /product="glyceraldehyde-3-phosphate dehydrogenase,
                     pseudogene 119"
                     /pseudo
                     /db_xref="GeneID:134486952"
                     /db_xref="RGD:401988152"
     exon            1..1286
                     /gene="Gapdh-ps119"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
ORIGIN      
ctctgctcctccctgttctagagacagccgcatcttcttgtgcagtgccagcctcgtctcatagacaagatggtgaaggtcggtgtgaacggatttggccgtatcggacgcctggttaccagggctgccttctcttgtgacaaagtggacattgttgccatcaacgaccccttcattgacctcaactacatggtctacatgttccagtatgactctacccacggcaagttcaacggcacagtcaaggctgagaatgggaagctggtcatcaacgggaaacccatcaccatcttccaggagcgagatcccgctaacatcaaatggggtgatgctggtgctgagtatgtcgtggagtctactggcgtcttcaccaccatggagaaggctggggctcacctgaagggtggggccaaaagggtcatcatctccgccccttccgctgatgcccccatgtttgtgatgggtgtgaaccacgagaaatatgacaactccctcaagattgtcagcaatgcatcctgcaccaccaactgcttagcccccctggccaaggtcatccatgacaactttggcatcgtggaagggctcatgaccacagtccatgccatcactgccactcagaagactgtggatggcccctctggaaagctgtggcgtgatggccgtggggcagcccagaacatcatccctgcatccactggtgctgccaaggctgtgggcaaggtcatcccagagctgaacgggaagctcactggcatggccttccgtgttcctacccccaatgtatccgttgtggatctgacatgccgcctggagaaacctgccaagtatgatgacatcaagaaggtggtgaagcaggcggccgagggcccactaaagggcatcctgggctacactgaggaccaggttgtctcctgtgacttcaacagcaactcccattcttccacctttgatgctggggctggcattgctctcaatgacaactttgtgaagctcatttcctggtatgacaatgaatatggctacagcaacagggtggtggacctcatggcctacatggcctccaaggagtaagaaaccctggaccacccagcccagcaaggatactgagagcaagagagaggccctcagttgctgaggagtccccatcccaactcagcccccaacactgagcatctccctcacaattccatcccagaccccataacaacaggagaggcctggggagccctcccttctctcgaataccatcaataaagttcgctgcaccctcttaaaaaaaaataaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]