LOCUS       NM_214258               1236 bp    mRNA    linear   MAM 07-FEB-2024
DEFINITION  Sus scrofa protein kinase cAMP-dependent type II regulatory subunit
            alpha (PRKAR2A), mRNA.
ACCESSION   NM_214258
VERSION     NM_214258.2
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1236)
  AUTHORS   Nishimura,T., Fujii,W., Sugiura,K. and Naito,K.
  TITLE     Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
            A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
            porcine full-grown and growing oocytes
  JOURNAL   Biol Reprod 90 (3), 58 (2014)
   PUBMED   24501172
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1236)
  AUTHORS   Nishimura,T., Sugiura,K. and Naito,K.
  TITLE     A-kinase anchor protein 1 (AKAP1) regulates cAMP-dependent protein
            kinase (PKA) localization and is involved in meiotic maturation of
            porcine oocytes
  JOURNAL   Biol Reprod 88 (4), 85 (2013)
   PUBMED   23426434
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1236)
  AUTHORS   Nishimura,T., Fujii,W., Kano,K., Sugiura,K. and Naito,K.
  TITLE     Analyses of the involvement of PKA regulation mechanism in meiotic
            incompetence of porcine growing oocytes
  JOURNAL   Biol Reprod 87 (3), 53 (2012)
   PUBMED   22674394
  REMARK    GeneRIF: Analyses of the involvement of PKA regulation mechanism in
            meiotic incompetence of porcine growing oocytes.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1236)
  AUTHORS   Hemmings,B.A., Schwarz,M., Adavani,S.R. and Jans,D.A.
  TITLE     Expression cloning of a cDNA encoding the type II regulatory
            subunit of the cAMP-dependent protein kinase
  JOURNAL   FEBS Lett 209 (2), 219-222 (1986)
   PUBMED   2431926
REFERENCE   5  (bases 1 to 1236)
  AUTHORS   Potter,R.L. and Taylor,S.S.
  TITLE     Correlation of the cAMP binding domain with a site of
            autophosphorylation on the regulatory subunit of cAMP-dependent
            protein kinase II from porcine skeletal muscle
  JOURNAL   J Biol Chem 254 (18), 9000-9005 (1979)
   PUBMED   225318
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB499528.1.
            
            On Jun 11, 2010 this sequence version replaced NM_214258.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB499528.1, SRR5275321.436620.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA103886111, SAMEA103886112
                                           [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1236
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="13"
                     /map="13"
     gene            1..1236
                     /gene="PRKAR2A"
                     /note="protein kinase cAMP-dependent type II regulatory
                     subunit alpha"
                     /db_xref="GeneID:397493"
                     /db_xref="VGNC:VGNC:91804"
     exon            1..254
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     CDS             2..1207
                     /gene="PRKAR2A"
                     /EC_number="2.7.11.1"
                     /note="cAMP-dependent protein kinase, regulatory subunit
                     alpha 2"
                     /codon_start=1
                     /product="cAMP-dependent protein kinase type II-alpha
                     regulatory subunit"
                     /protein_id="NP_999423.2"
                     /db_xref="GeneID:397493"
                     /db_xref="VGNC:VGNC:91804"
                     /translation="

MSHIQIPPGLTELLQGYTVEVLRRQPPDLVDFAVDYFTRLREARSRASTPPAAPPSGSQDLEPSSGLVTDAIADSESEDDEDLDVPIPSRFDRRVSVCAETYNPDEEEEDTDPRVIHPKTDQQRCRLQEACKDILLFKNLDQEQLSQVLDAMFERTVKVDEHVIDQGDDGDNFYVIERGTYDILVTKDNQTRSVGQYDNHGSFGELALMYNTPRAATIVATSEGSLWGLDRVTFRRIIVKNNAKKRKMFESFIESVPLLKSLEVSERMKIVDVIGEKIYKDGERIITQGEKADSFYIIESGEVSILIKSKTKANKDGGNQEVEIARCHKGQYFGELALVTNKPRAASAYAVGDVKCLVMDVQAFERLLGPCMDIMKRNISHYEEQLVKMFGSSMDLIDPGQ"

     misc_feature    11..133
                     /gene="PRKAR2A"
                     /note="dimerization/docking (D/D) domain of the Type II
                     alpha Regulatory subunit of cAMP-dependent protein kinase;
                     Region: DD_RIIalpha_PKA; cd12103"
                     /db_xref="CDD:438524"
     misc_feature    order(11..25,29..31,38..43,50..55,62..67,74..76,83..94,
                     98..103,110..115,119..124)
                     /gene="PRKAR2A"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:438524"
     misc_feature    order(17..19,29..34,41..46,53..58,65..70)
                     /gene="PRKAR2A"
                     /note="AKAP interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:438524"
     misc_feature    407..745
                     /gene="PRKAR2A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(611..616,641..649)
                     /gene="PRKAR2A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(707..715,725..733)
                     /gene="PRKAR2A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    773..1138
                     /gene="PRKAR2A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(1001..1006,1031..1039)
                     /gene="PRKAR2A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(1097..1105,1115..1123)
                     /gene="PRKAR2A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     exon            255..290
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            291..343
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            344..427
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            428..534
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            535..688
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            689..790
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            791..865
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            866..931
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            932..1073
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            1074..1236
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

catgagccacatccagatcccgcctgggctcacggagctgctgcagggctacaccgtggaggtgctgcggcggcagccacccgacctggtcgacttcgcggtggactacttcacccgcctgcgcgaggcccgctcccgagcctccaccccacccgccgcccctccttccggctcccaggatctagagcccagctctggccttgtcaccgacgcgatcgcggacagcgagtcggaggacgacgaggacttggacgttccaattcctagcagatttgatcggcgagtatcagtctgtgctgagacctataaccctgatgaggaagaggaagatactgatccaagggtgattcaccctaaaactgatcaacaaagatgcagacttcaagaagcttgcaaagatattcttcttttcaaaaatcttgatcaggaacaactttctcaagtcctcgatgctatgtttgaaaggacagtcaaagttgatgagcatgtcattgaccaaggagatgatggagacaacttttatgttattgaacggggaacctatgatattttagtaacaaaagataatcaaacccgctctgttggtcagtatgacaaccatggcagttttggagaactagctctgatgtacaacaccccgagagctgctaccattgtcgccacttcagaaggctccctttggggactggaccgtgtgacttttagaagaatcatagtgaaaaacaatgcaaaaaagaggaagatgtttgaatcatttattgaatctgtgccactccttaaatcactagaggtgtcagaacgaatgaagatcgtggatgtaataggagaaaagatctataaggatggagagcgcatcatcacacagggtgaaaaggctgatagcttttacattatagagtctggtgaagtgagcatcttgattaaaagcaagactaaagcaaacaaggatggtgggaaccaggaggtcgagattgcccgctgccacaaggggcagtactttggagagcttgcactggtcaccaacaaacccagagctgcttcagcttatgcagtgggagatgtcaaatgcttagttatggatgtacaagcatttgagaggcttctggggccctgcatggacatcatgaagaggaacatctcacactatgaggaacagctggtgaagatgtttggctccagcatggatctgatcgatcccgggcagtaggtgtgccacaccccagagccttctcagtg

//