ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-11-19 20:42:09, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_214026 1425 bp mRNA linear MAM 02-JUN-2024
DEFINITION Sus scrofa protein kinase cAMP-dependent type I regulatory subunit
alpha (PRKAR1A), mRNA.
ACCESSION NM_214026
VERSION NM_214026.1
KEYWORDS RefSeq.
SOURCE Sus scrofa (pig)
ORGANISM Sus scrofa
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
Sus.
REFERENCE 1 (bases 1 to 1425)
AUTHORS Nishimura,T., Fujii,W., Sugiura,K. and Naito,K.
TITLE Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
porcine full-grown and growing oocytes
JOURNAL Biol Reprod 90 (3), 58 (2014)
PUBMED 24501172
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1425)
AUTHORS Nishimura,T., Fujii,W., Kano,K., Sugiura,K. and Naito,K.
TITLE Analyses of the involvement of PKA regulation mechanism in meiotic
incompetence of porcine growing oocytes
JOURNAL Biol Reprod 87 (3), 53 (2012)
PUBMED 22674394
REMARK GeneRIF: Analyses of the involvement of PKA regulation mechanism in
meiotic incompetence of porcine growing oocytes.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1425)
AUTHORS Cabral,L.M., Wengert,M., da Ressurreicao,A.A., Feres-Elias,P.H.,
Almeida,F.G., Vieyra,A., Caruso-Neves,C. and Einicker-Lamas,M.
TITLE Ceramide is a potent activator of plasma membrane Ca2+-ATPase from
kidney-promixal tubule cells with protein kinase A as an
intermediate
JOURNAL J Biol Chem 282 (34), 24599-24606 (2007)
PUBMED 17606608
REMARK GeneRIF: ceramide activates plasma membrane Ca2+-ATPase from
kidney-promixal tubule cells with protein kinase A as an
intermediate
REFERENCE 4 (bases 1 to 1425)
AUTHORS Uenishi,H., Eguchi-Ogawa,T., Shinkai,H., Okumura,N., Suzuki,K.,
Toki,D., Hamasima,N. and Awata,T.
TITLE PEDE (Pig EST Data Explorer) has been expanded into Pig Expression
Data Explorer, including 10 147 porcine full-length cDNA sequences
JOURNAL Nucleic Acids Res 35 (Database issue), D650-D653 (2007)
PUBMED 17145712
REFERENCE 5 (bases 1 to 1425)
AUTHORS Uenishi,H., Eguchi,T., Suzuki,K., Sawazaki,T., Toki,D., Shinkai,H.,
Okumura,N., Hamasima,N. and Awata,T.
TITLE PEDE (Pig EST Data Explorer): construction of a database for ESTs
derived from porcine full-length cDNA libraries
JOURNAL Nucleic Acids Res 32 (Database issue), D484-D488 (2004)
PUBMED 14681463
REFERENCE 6 (bases 1 to 1425)
AUTHORS Mellink,C., Lahbib-Mansais,Y., Yerle,M. and Gellin,J.
TITLE Mapping of the regulatory type I alpha and catalytic beta subunits
of cAMP-dependent protein kinase and interleukin 1 alpha and 1 beta
in the pig
JOURNAL Mamm Genome 5 (5), 298-302 (1994)
PUBMED 8075502
REFERENCE 7 (bases 1 to 1425)
AUTHORS Bubis,J., Vedvick,T.S. and Taylor,S.S.
TITLE Antiparallel alignment of the two protomers of the regulatory
subunit dimer of cAMP-dependent protein kinase I
JOURNAL J Biol Chem 262 (31), 14961-14966 (1987)
PUBMED 3667618
REFERENCE 8 (bases 1 to 1425)
AUTHORS Nowak,I., Seipel,K., Schwarz,M., Jans,D.A. and Hemmings,B.A.
TITLE Isolation of a cDNA and characterization of the 5' flanking region
of the gene encoding the type I regulatory subunit of the
cAMP-dependent protein kinase
JOURNAL Eur J Biochem 167 (1), 27-33 (1987)
PUBMED 3040400
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from X05942.1.
##Evidence-Data-START##
Transcript exon combination :: X05942.1, AK238988.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN02389762, SAMN02584787
[ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..1425
/organism="Sus scrofa"
/mol_type="mRNA"
/db_xref="taxon:9823"
/chromosome="12"
/map="12"
gene 1..1425
/gene="PRKAR1A"
/note="protein kinase cAMP-dependent type I regulatory
subunit alpha"
/db_xref="GeneID:397091"
/db_xref="VGNC:VGNC:91802"
CDS 81..1223
/gene="PRKAR1A"
/EC_number="2.7.11.1"
/note="cAMP-dependent protein kinase type I regulatory
subunit; protein kinase, cAMP-dependent, regulatory, type
I, alpha (tissue specific extinguisher 1)"
/codon_start=1
/product="cAMP-dependent protein kinase type I-alpha
regulatory subunit"
/protein_id="NP_999191.1"
/db_xref="GeneID:397091"
/db_xref="VGNC:VGNC:91802"
/translation="
MASGSTASEEERSLRECELYVQKHNIQALLKDSIVQLCTARPERPMAFLREYFERLEKEEAKQIQNLQKASARADSREDEISPPPPNPVVKGRRRRGAISAEVYTEEDAASYVRKVIPKDYKTMAALAKAIEKNVLFSHLDDNERSDIFDAMFPVSFIAGETVIQQGDEGDNFYVIDQGEMDVYVNNEWATSVGEGGSFGELALIYGTPRAATVKAKTNVKLWGNDRDSYRRILMGSTLRKRKMYEEFLSKVSILESLDKWERLTVADALEPVQFEDGQKIVVQGEPGDEFFIILEGSAAVLQRRSENEEFVEVGRLGPSDYFGEIALLMNRPRAATVVARGPLKCVKLDRPRFERVLGPCSDILKRNIQQYNSFVSLSV"
misc_feature 81..83
/gene="PRKAR1A"
/note="N-acetylmethionine.
/evidence=ECO:0000250|UniProtKB:P10644; propagated from
UniProtKB/Swiss-Prot (P07802.2); acetylation site"
misc_feature 84..485
/gene="PRKAR1A"
/note="propagated from UniProtKB/Swiss-Prot (P07802.2);
Region: Dimerization and phosphorylation"
misc_feature 84..86
/gene="PRKAR1A"
/note="N-acetylalanine, in cAMP-dependent protein kinase
type I-alpha regulatory subunit, N-terminally processed.
/evidence=ECO:0000250|UniProtKB:P00514; propagated from
UniProtKB/Swiss-Prot (P07802.2); acetylation site"
misc_feature 87..89
/gene="PRKAR1A"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P09456; propagated from
UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
misc_feature 117..266
/gene="PRKAR1A"
/note="dimerization/docking (D/D) domain of the Type I
alpha Regulatory subunit of cAMP-dependent protein kinase;
Region: DD_RIalpha_PKA; cd12101"
/db_xref="CDD:438522"
misc_feature order(120..122,129..134,159..164,168..173,180..185)
/gene="PRKAR1A"
/note="AKAP interaction site [polypeptide binding]; other
site"
/db_xref="CDD:438522"
misc_feature order(129..131,138..143,156..158,165..170,177..182,
189..194,204..206,210..221,225..230,237..242,249..251)
/gene="PRKAR1A"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:438522"
misc_feature 270..368
/gene="PRKAR1A"
/note="propagated from UniProtKB/Swiss-Prot (P07802.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 306..308
/gene="PRKAR1A"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P10644; propagated from
UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
misc_feature 324..326
/gene="PRKAR1A"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P10644; propagated from
UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
misc_feature 363..377
/gene="PRKAR1A"
/note="propagated from UniProtKB/Swiss-Prot (P07802.2);
Region: Pseudophosphorylation motif"
misc_feature 378..380
/gene="PRKAR1A"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9DBC7; propagated from
UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
misc_feature 486..815
/gene="PRKAR1A"
/note="effector domain of the CAP family of transcription
factors; members include CAP (or cAMP receptor protein
(CRP)), which binds cAMP, FNR (fumarate and nitrate
reduction), which uses an iron-sulfur cluster to sense
oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
cd00038"
/db_xref="CDD:237999"
misc_feature order(678..683,708..716)
/gene="PRKAR1A"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:237999"
misc_feature order(774..782,792..800)
/gene="PRKAR1A"
/note="flexible hinge region; other site"
/db_xref="CDD:237999"
misc_feature 840..1187
/gene="PRKAR1A"
/note="effector domain of the CAP family of transcription
factors; members include CAP (or cAMP receptor protein
(CRP)), which binds cAMP, FNR (fumarate and nitrate
reduction), which uses an iron-sulfur cluster to sense
oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
cd00038"
/db_xref="CDD:237999"
misc_feature 849..851
/gene="PRKAR1A"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P09456; propagated from
UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
misc_feature order(1050..1055,1080..1088)
/gene="PRKAR1A"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:237999"
misc_feature order(1146..1154,1164..1172)
/gene="PRKAR1A"
/note="flexible hinge region; other site"
/db_xref="CDD:237999"
ORIGIN
gaattccgctgagggagctcagcaagccgtcacctcacaccggtaatcccgtgcccgccgccgtctgtccccagggaaccatggcgtctggcagcaccgccagtgaggaggagcgtagcctccgggaatgtgagctctacgtccagaagcacaacattcaggccctgctcaaggattctatcgtgcagttgtgcactgcgcggcccgagagacccatggcattcctcagggaatacttcgagaggttggagaaggaggaggcaaagcagatccagaatctgcagaaagcaagtgcccgggcagactcgagggaggatgaaatctctcctcctccacccaacccagtggtaaagggccgaaggcgacgaggtgctatcagtgctgaggtctatacggaggaagatgctgcatcatatgttagaaaggttataccaaaagattataagacaatggctgctttagctaaagccattgaaaagaatgtactgttttcacatcttgatgataatgagagaagtgatatttttgatgccatgtttccggtttcctttattgctggagagactgttattcagcaaggtgatgaaggggataacttctatgtgattgatcaaggagagatggatgtctatgtcaacaatgagtgggcaaccagtgttggggaaggaggaagctttggagaacttgctctgatttatggtacacctagagcagccactgtcaaggcaaagacaaatgtgaaattgtggggtaatgaccgagacagctacagaagaatccttatgggaagcacgctgagaaagcggaagatgtatgaggagtttcttagtaaagtgtctattttagaatctctggacaagtgggaacgtcttactgttgctgatgcgttggaaccagtccagtttgaagatggacagaagattgtggtgcagggagaaccaggggacgagttcttcattattttagagggttcggctgctgtactacagcgtcgttcagaaaacgaagagtttgttgaagtgggaagattggggccttctgattattttggcgaaatcgcactactgatgaatcgtcctcgcgctgccactgtggttgctcgtggcccgttgaagtgcgttaagctggaccgacctagatttgaacgtgttcttggcccgtgctcagatatcctcaaacgaaacatccagcagtacaacagttttgtgtcactgtctgtctgaaatatgcctcctgtgcctctctcttcttttctccccagtcttcactcatgcagactgctttctggtccctctttgcagcaccacgtggccactggcatcgcagcttcttgtcagtttatattaaaagttgcttttattgcaccgttttattttggagcattaactgagtgctcatacacagttaaataaatagaaagaattc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]