LOCUS       NM_017339               1060 bp    mRNA    linear   ROD 03-APR-2024
DEFINITION  Rattus norvegicus ISL LIM homeobox 1 (Isl1), mRNA.
ACCESSION   NM_017339
VERSION     NM_017339.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1060)
  AUTHORS   Wu,S.H., Wang,X.H., Xu,Y.J., Gu,J.N., Yang,C.X., Qiao,Q., Guo,X.J.,
            Guo,Y.H., Qiu,X.B., Jiang,W.F. and Yang,Y.Q.
  TITLE     ISL1 loss-of-function variation causes familial atrial fibrillation
  JOURNAL   Eur J Med Genet 63 (11), 104029 (2020)
   PUBMED   32771629
REFERENCE   2  (bases 1 to 1060)
  AUTHORS   Sun,Q., Zeng,J., Liu,Y., Chen,J., Zeng,Q.C., Chen,Y.Q., Tu,L.L.,
            Chen,P., Yang,F. and Zhang,M.
  TITLE     microRNA-9 and -29a regulate the progression of diabetic peripheral
            neuropathy via ISL1-mediated sonic hedgehog signaling pathway
  JOURNAL   Aging (Albany NY) 12 (12), 11446-11465 (2020)
   PUBMED   32544883
REFERENCE   3  (bases 1 to 1060)
  AUTHORS   Liang,L., Su,W., Zhou,L., Cao,Y., Zhou,X., Liu,S., Zhao,Y.,
            Ding,X., Wang,Q. and Zhang,H.
  TITLE     Statin downregulation of miR-652-3p protects endothelium from
            dyslipidemia by promoting ISL1 expression
  JOURNAL   Metabolism 107, 154226 (2020)
   PUBMED   32277945
REFERENCE   4  (bases 1 to 1060)
  AUTHORS   Wang,Z., Song,H.M., Wang,F., Zhao,C.M., Huang,R.T., Xue,S.,
            Li,R.G., Qiu,X.B., Xu,Y.J., Liu,X.Y. and Yang,Y.Q.
  TITLE     A New ISL1 Loss-of-Function Mutation Predisposes to Congenital
            Double Outlet Right Ventricle
  JOURNAL   Int Heart J 60 (5), 1113-1122 (2019)
   PUBMED   31484864
REFERENCE   5  (bases 1 to 1060)
  AUTHORS   Xu,Y.J., Wang,Z.S., Yang,C.X., Di,R.M., Qiao,Q., Li,X.M., Gu,J.N.,
            Guo,X.J. and Yang,Y.Q.
  TITLE     Identification and Functional Characterization of an ISL1 Mutation
            Predisposing to Dilated Cardiomyopathy
  JOURNAL   J Cardiovasc Transl Res 12 (3), 257-267 (2019)
   PUBMED   30536204
REFERENCE   6  (bases 1 to 1060)
  AUTHORS   Ahlgren,U., Pfaff,S.L., Jessell,T.M., Edlund,T. and Edlund,H.
  TITLE     Independent requirement for ISL1 in formation of pancreatic
            mesenchyme and islet cells
  JOURNAL   Nature 385 (6613), 257-260 (1997)
   PUBMED   9000074
REFERENCE   7  (bases 1 to 1060)
  AUTHORS   Pfaff,S.L., Mendelsohn,M., Stewart,C.L., Edlund,T. and Jessell,T.M.
  TITLE     Requirement for LIM homeobox gene Isl1 in motor neuron generation
            reveals a motor neuron-dependent step in interneuron
            differentiation
  JOURNAL   Cell 84 (2), 309-320 (1996)
   PUBMED   8565076
REFERENCE   8  (bases 1 to 1060)
  AUTHORS   Wang,M. and Drucker,D.J.
  TITLE     The LIM domain homeobox gene isl-1 is a positive regulator of islet
            cell-specific proglucagon gene transcription
  JOURNAL   J Biol Chem 270 (21), 12646-12652 (1995)
   PUBMED   7759514
REFERENCE   9  (bases 1 to 1060)
  AUTHORS   Wang,M. and Drucker,D.J.
  TITLE     The LIM domain homeobox gene isl-1: conservation of human, hamster,
            and rat complementary deoxyribonucleic acid sequences and
            expression in cell types of nonneuroendocrine lineage
  JOURNAL   Endocrinology 134 (3), 1416-1422 (1994)
   PUBMED   7907017
REFERENCE   10 (bases 1 to 1060)
  AUTHORS   Karlsson,O., Thor,S., Norberg,T., Ohlsson,H. and Edlund,T.
  TITLE     Insulin gene enhancer binding protein Isl-1 is a member of a novel
            class of proteins containing both a homeo- and a Cys-His domain
  JOURNAL   Nature 344 (6269), 879-882 (1990)
   PUBMED   1691825
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from S69329.1.
            
            On Apr 28, 2006 this sequence version replaced NM_017339.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: S69329.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760389 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1060
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="2"
                     /map="2q14"
     gene            1..1060
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="ISL LIM homeobox 1"
                     /db_xref="GeneID:64444"
                     /db_xref="RGD:61957"
     exon            1..33
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     CDS             6..1055
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="islet-1; isl-1 homeobox; ISL1 transcription factor,
                     LIM/homeodomain 1; ISL1 transcription factor
                     LIM/homeodomain (islet-1)"
                     /codon_start=1
                     /product="insulin gene enhancer protein ISL-1"
                     /protein_id="NP_059035.3"
                     /db_xref="GeneID:64444"
                     /db_xref="RGD:61957"
                     /translation="

MGDMGDPPKKKRLISLCVGCGNQIHDQYILRVSPDLEWHAACLKCAECNQYLDESCTCFVRDGKTYCKRDYIRLYGIKCAKCSIGFSKNDFVMRARSKVYHIECFRCVACSRQLIPGDEFALREDGLFCRADHDVVERASLGAGDPLSPLHPARPLQMAAEPISARQPALRPHVHKQPEKTTRVRTVLNEKQLHTLRTCYAANPRPDALMKEQLVEMTGLSPRVIRVWFQNKRCKDKKRSIMMKQLQQQQPNDKTNIQGMTGTPMVAASPERHDGGLQANPVEVQSYQPPWKVLSDFALQSDIDQPAFQQLVNFSEGGPGSNSTGSEVASMSSQLPDTPNSMVASPIEA"

     misc_feature    54..218
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="The first LIM domain of Isl, a member of LHX
                     protein family; Region: LIM1_Isl; cd09366"
                     /db_xref="CDD:188752"
     misc_feature    order(54..56,63..65,120..122,129..131,138..140,147..149,
                     204..206,213..215)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188752"
     misc_feature    240..404
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="The second LIM domain of Isl, a member of LHX
                     protein family; Region: LIM2_Isl; cd09374"
                     /db_xref="CDD:188760"
     misc_feature    order(240..242,249..251,306..308,315..317,324..326,
                     333..335,390..392,399..401)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188760"
     misc_feature    546..716
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    order(552..563,567..569,618..620,636..638,675..677,
                     681..686,693..698,702..710,714..719)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(555..557,564..566,684..686,693..698,705..707)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    789..878
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="propagated from UniProtKB/Swiss-Prot (P61374.1);
                     Region: LIM-binding domain (LID). /evidence=ECO:0000250"
     misc_feature    939..1052
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="propagated from UniProtKB/Swiss-Prot (P61374.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            34..223
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            224..483
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            484..770
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            771..938
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            939..1060
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cagatatgggagacatgggcgatccaccaaaaaaaaaacgtctgatttccctatgtgttggttgcggtaatcaaattcacgatcagtatattctgagggtttctccggatttggaatggcatgcggcatgtttgaaatgtgcggagtgtaatcagtatttggacgaaagctgtacctgctttgttagggacgggaaaacctactgtaaaagagattatatcaggttgtacgggatcaaatgcgccaagtgcagcataggcttcagcaagaacgacttcgtgatgcgcgcccgctctaaggtgtaccacatcgaatgtttccgctgtgtagcatgcagccgacagctcatcccgggagacgaattcgcgctgcgggaggatgggcttttctgccgcgcggaccacgatgtagtggagagggccagcctaggagctggagaccctctcagtcccttgcatccagcgcggcctctgcaaatggcagccgagcccatctccgctaggcagccagctctgcggccgcacgtccacaaacagcccgagaagaccacccgagtgcggactgtgctcaacgaaaagcagctgcacaccttgcggacctgctacgcagccaaccctcggccagatgcgctcatgaaggagcaactagtggagatgaccggcctcagtccccgagtcatccgggtctggtttcaaaacaagaggtgcaaggacaagaaacgcagcatcatgatgaagcagctccagcagcagcaacccaacgacaaaactaatatccaggggatgacaggaactcccatggtggctgctagtccggagagacatgatggtggtttacaggctaacccagttgaggtgcaaagttaccagccgccctggaaagtactgagtgacttcgccttgcaaagtgacatagatcagcctgcttttcagcaactggtcaatttttcagaaggaggaccaggctctaattccactggcagtgaagtagcatcgatgtcctctcagctcccagatacacccaacagcatggtagccagtcctatagaggcatgaggaac

//