LOCUS       NM_001003088            1006 bp    mRNA    linear   MAM 02-APR-2024
DEFINITION  Canis lupus familiaris claudin 3 (CLDN3), mRNA.
ACCESSION   NM_001003088
VERSION     NM_001003088.1
KEYWORDS    RefSeq.
SOURCE      Canis lupus familiaris (dog)
  ORGANISM  Canis lupus familiaris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
            Canis.
REFERENCE   1  (bases 1 to 1006)
  AUTHORS   Furuse,M., Furuse,K., Sasaki,H. and Tsukita,S.
  TITLE     Conversion of zonulae occludentes from tight to leaky strand type
            by introducing claudin-2 into Madin-Darby canine kidney I cells
  JOURNAL   J Cell Biol 153 (2), 263-272 (2001)
   PUBMED   11309408
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF358908.1.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AF358908.1, SRR10915302.2005862.1
                                        [ECO:0000345]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1006
                     /organism="Canis lupus familiaris"
                     /mol_type="mRNA"
                     /sub_species="familiaris"
                     /db_xref="taxon:9615"
                     /chromosome="6"
                     /map="6"
     gene            1..1006
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="claudin 3"
                     /db_xref="GeneID:403648"
                     /db_xref="VGNC:VGNC:39319"
     exon            1..1006
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    56..58
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="upstream in-frame stop codon"
     CDS             209..865
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="localizes to tight junctions; integral membrane
                     protein claudin-3"
                     /codon_start=1
                     /product="claudin-3"
                     /protein_id="NP_001003088.1"
                     /db_xref="GeneID:403648"
                     /db_xref="VGNC:VGNC:39319"
                     /translation="

MSMGLEIAGTSLAVLGWLSTIVCCALPMWRVTAFIGSSIITAQITWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARALIVVSILLAAFGLLVALVGAQCTNCVQDDTAKAKITIVAGVLFLLAALLTLVPVSWSANTIIRDFYNPLVPDAQKREMGAGLYVGWAAAALQLLGGALLCCSCPPRDKKYAPTKIVYSAPRSAGPGTSTAYDRKDYV"

     misc_feature    215..709
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     misc_feature    233..295
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q95KM5.1);
                     transmembrane region"
     misc_feature    449..511
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q95KM5.1);
                     transmembrane region"
     misc_feature    554..616
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q95KM5.1);
                     transmembrane region"
     misc_feature    686..748
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q95KM5.1);
                     transmembrane region"
     misc_feature    800..802
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z0G9; propagated from
                     UniProtKB/Swiss-Prot (Q95KM5.1); phosphorylation site"
     misc_feature    803..805
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q63400; propagated from
                     UniProtKB/Swiss-Prot (Q95KM5.1); phosphorylation site"
     misc_feature    833..835
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O15551; propagated from
                     UniProtKB/Swiss-Prot (Q95KM5.1); phosphorylation site"
     misc_feature    857..862
                     /gene="CLDN3"
                     /gene_synonym="Claudin-3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q95KM5.1);
                     Region: Interactions with TJP1, TJP2 and TJP3.
                     /evidence=ECO:0000250"
ORIGIN      

aaagcacaggcaggtgcaggcgctgccccggcgccagcgggcagaacggagccgttagcgcgcgccgtcggtgcctccgtccttccgtccgtccgtcgaggcatcggtcggccggcgcgcggcagctcccgcccaggcccagcggccacggcccctcgtcgccccgcaccctgagccgccgggcagagccggctttggcgcggcagccatgtccatgggcctggagatcgcgggcacgtcgctggccgtgctgggctggctgagcaccatcgtgtgctgcgcgctgcccatgtggcgcgtgacggccttcatcggcagcagcatcatcacggcgcagatcacctgggagggcctgtggatgaactgcgtggtgcagagcaccggccagatgcagtgcaaggtgtacgactcgctgctggcgctgccgcaggacctgcaggcggcccgcgccctcatcgtcgtgtccatcctgctggccgccttcgggctcctcgtggcactcgtgggcgcccagtgcaccaactgcgtgcaggacgacacggccaaggccaagatcaccatcgtggcgggagtgctcttcctgctggccgccttgctcaccctggtgccggtgtcctggtcggccaacaccatcatccgggacttctacaacccgctggtgccggacgcgcagaagcgggagatgggcgcgggcctgtacgtgggctgggcggccgcggctctgcagctgctggggggcgcgctgctctgctgctcctgcccgccgcgcgacaagaagtacgcgcccaccaagatcgtctactccgcgccgcgctccgccggccccggcaccagcacagcctacgaccgcaaggactacgtgtgaggggcagcggcggggagcccccagcacccgtcgagctacagcgcccctgtccggcgtgcagcctctcggagaccaacccactccagacgccccgagctctcccacgggactgggaggggccagcccggcggccccttcccc

//