GGRNA Home | Help | Advanced search

2018-10-20 19:30:23, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:hits:results:
seq3:caaggagagatgggacac121 NM_000092, NM_000094, NM_000129, NM_001031853, NM_001039770, NM_001042536, NM_001042594, NM_001080460, NM_001100112, NM_001102608, NM_001114133, NM_001134672, NM_001134870, NM_001135686, NM_001136238, [...]
[AND] 121 NM_000092, NM_000094, NM_000129, NM_001031853, NM_001039770, NM_001042536, NM_001042594, NM_001080460, NM_001100112, NM_001102608, NM_001114133, NM_001134672, NM_001134870, NM_001135686, NM_001136238, [...]

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens collagen, type IV, alpha 4 (COL4A4), mRNA. (10341 bp)
..... tgcctgggctgaggggacagccaggagaaatgggagaccctgggccaagaggcctcca .....
position 4084 (CDS: 655 - 5727)
Synonym: CA44
NM_000092.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type VII, alpha 1 (COL7A1), mRNA. (9169 bp)
..... tcccgggtcagacaggccctcgaggagagatgggtcagccaggccctagtggagagcg .....
position 7235 (CDS: 2 - 8836)
Synonym: EBD1; EBDCT; EBR1
NM_000094.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coagulation factor XIII, A1 polypeptide (F13A1), mRNA. (3863 bp)
..... gtcacgagcgttcacctgttcaaggagagatgggacactaacaaggtggaccaccaca .....
position 285 (CDS: 124 - 2322)
Synonym: F13A
NM_000129.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inscuteable homolog (Drosophila) (INSC), transcript variant 1, mRNA. (2970 bp)
..... ctcctggaagcctgcagtgacaagcagagagtggacacgccttacactcgggaccaga .....
position 1321 (CDS: 47 - 1786)
NM_001031853.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane protein with metallophosphoesterase domain (TMPPE), transcript variant 1, mRNA. (3985 bp)
..... tggagataaggaaaccaaggcaaagagagatagggcacaggcagtatgacaagatatg .....
position 2382 (CDS: 192 - 1553)
NM_001039770.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inscuteable homolog (Drosophila) (INSC), transcript variant 2, mRNA. (2894 bp)
..... ctcctggaagcctgcagtgacaagcagagagtggacacgccttacactcgggaccaga .....
position 1245 (CDS: 112 - 1710)
NM_001042536.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protection of telomeres 1 (POT1), transcript variant 4, mRNA. (3964 bp)
..... ttttttagcttcttcatctacaagcagagatggtaaaccttgcatatttttgaaagca .....
position 498 (CDS: 864 - 2375)
Synonym: HPOT1
NM_001042594.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine-rich repeats and IQ motif containing 4 (LRRIQ4), mRNA. (1825 bp)
..... agaacaaaataggtgccatcccagaagagatcggacacctgacggggctgcagaagtt .....
position 610 (CDS: 1 - 1683)
Synonym: LRRC64
NM_001080460.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin, heavy chain 2, skeletal muscle, adult (MYH2), transcript variant 2, mRNA. (6163 bp)
..... agacagatatttcccaaatgcaaggagagatggaggacattctccaggaagcccgcaa .....
position 5358 (CDS: 129 - 5954)
Synonym: MYH2A; MYHas8; MyHC-2A; MyHC-IIa; MYHSA2
NM_001100112.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type VI, alpha 6 (COL6A6), mRNA. (8475 bp)
..... aaatgatatctgctgggcttccaggagagatgggatcccctggggaaccaggacctcc .....
position 5138 (CDS: 32 - 6823)
NM_001102608.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptopodin 2-like (SYNPO2L), transcript variant 1, mRNA. (4933 bp)
..... acaggcacaggtcccaggaccaaggagaggtggaacatccagttcctaaagttgcttc .....
position 3107 (CDS: 153 - 3086)
NM_001114133.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 204, member A (FAM204A), transcript variant 2, mRNA. (2565 bp)
..... cttgcatgggggtttgaagcaaagaagagatgggaaaccaaaagcaacatgggataca .....
position 726 (CDS: 67 - 768)
Synonym: bA319I23.1; C10orf84; RP11-319I23.1
NM_001134672.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein phosphatase 1, regulatory subunit 18 (PPP1R18), transcript variant 2, mRNA. (2969 bp)
..... ctcgggactggaggcaaagcccaggagaggtgggagacaggagctcccgactgtcaga .....
position 757 (CDS: 232 - 2073)
Synonym: HKMT1098; KIAA1949
NM_001134870.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens T cell-interacting, activating receptor on myeloid cells 1 (TARM1), mRNA. (897 bp)
..... gtgcgtgggccaaggagacacaaggggagatgggtcactgcccaagccgtccctcagt .....
position 84 (CDS: 26 - 841)
Synonym: OLT-2
NM_001135686.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane protein with metallophosphoesterase domain (TMPPE), transcript variant 2, mRNA. (3470 bp)
..... tggagataaggaaaccaaggcaaagagagatagggcacaggcagtatgacaagatatg .....
position 1867 (CDS: 88 - 1038)
NM_001136238.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neuropeptide FF receptor 2 (NPFFR2), transcript variant 3, mRNA. (2052 bp)
..... gtgactgctatgttcatcatgaatgagaaatgggacacaaactcttcagaaaactggc .....
position 403 (CDS: 392 - 1663)
Synonym: GPR74; HLWAR77; NPFF2; NPGPR
NM_001144756.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), transcript variant 2, mRNA. (6599 bp)
..... ttgaaaccttatgattttcccaaggggagatgggacagtgtcatctaaatattccgaa .....
position 3595 (CDS: 113 - 2719)
Synonym: PTP-H1; PTPH1
NM_001145368.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), transcript variant 3, mRNA. (8783 bp)
..... ttgaaaccttatgattttcccaaggggagatgggacagtgtcatctaaatattccgaa .....
position 5779 (CDS: 2555 - 4903)
Synonym: PTP-H1; PTPH1
NM_001145369.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), transcript variant 4, mRNA. (8648 bp)
..... ttgaaaccttatgattttcccaaggggagatgggacagtgtcatctaaatattccgaa .....
position 5644 (CDS: 2555 - 4768)
Synonym: PTP-H1; PTPH1
NM_001145370.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), transcript variant 5, mRNA. (6217 bp)
..... ttgaaaccttatgattttcccaaggggagatgggacagtgtcatctaaatattccgaa .....
position 3213 (CDS: 457 - 2337)
Synonym: PTP-H1; PTPH1
NM_001145371.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), transcript variant 6, mRNA. (6082 bp)
..... ttgaaaccttatgattttcccaaggggagatgggacagtgtcatctaaatattccgaa .....
position 3078 (CDS: 457 - 2202)
Synonym: PTP-H1; PTPH1
NM_001145372.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lysine (K)-specific demethylase 3A (KDM3A), transcript variant 2, mRNA. (4638 bp)
..... cattccactgcccgagtacacaaggcgagatggcaaactgaatttggcctctaggctg .....
position 3282 (CDS: 59 - 4024)
Synonym: JHDM2A; JHMD2A; JMJD1; JMJD1A; TSGA
NM_001146688.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens BEN domain containing 4 (BEND4), transcript variant 2, mRNA. (8779 bp)
..... ggatgaggctgtaaattcttcaaagaaagatgggagacggctccttcgatacctcatc .....
position 1800 (CDS: 581 - 1906)
Synonym: CCDC4
NM_001159547.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phosphate cytidylyltransferase 1, choline, beta (PCYT1B), transcript variant 2, mRNA. (5507 bp)
..... tttagcatctagtcataccccagggagagatgcgagacggtgtcactggctcagctga .....
position 5041 (CDS: 231 - 1286)
Synonym: CCTB; CTB
NM_001163264.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phosphate cytidylyltransferase 1, choline, beta (PCYT1B), transcript variant 3, mRNA. (5239 bp)
..... tttagcatctagtcataccccagggagagatgcgagacggtgtcactggctcagctga .....
position 4773 (CDS: 234 - 1226)
Synonym: CCTB; CTB
NM_001163265.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phospholipase B1 (PLB1), transcript variant 2, mRNA. (5115 bp)
..... caaaacacactcaccccactgaacgagagaggggacactgacctcaccttcttctccg .....
position 4007 (CDS: 45 - 4388)
Synonym: hPLB; PLB; PLB/LIP
NM_001170585.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens germinal center-associated, signaling and motility (GCSAM), transcript variant 3, mRNA. (3355 bp)
..... gtgggatgggggatctgcctgaagcagggatgggacacaaagtccctccagcttatct .....
position 793 (CDS: 186 - 728)
Synonym: GCAT2; GCET2; HGAL
NM_001190259.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens germinal center-associated, signaling and motility (GCSAM), transcript variant 4, mRNA. (3304 bp)
..... gtgggatgggggatctgcctgaagcagggatgggacacaaagtccctccagcttatct .....
position 742 (CDS: 186 - 677)
Synonym: GCAT2; GCET2; HGAL
NM_001190260.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dedicator of cytokinesis 8 (DOCK8), transcript variant 2, mRNA. (7159 bp)
..... agattgaaaaagtcctgcagcagggagagattggagactgtgcagagccctacacggt .....
position 960 (CDS: 102 - 6101)
Synonym: MRD2; ZIR8
NM_001190458.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dedicator of cytokinesis 8 (DOCK8), transcript variant 3, mRNA. (7255 bp)
..... agattgaaaaagtcctgcagcagggagagattggagactgtgcagagccctacacggt .....
position 960 (CDS: 102 - 6197)
Synonym: MRD2; ZIR8
NM_001193536.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens extracellular matrix protein 2, female organ and adipocyte specific (ECM2), transcript variant 2, mRNA. (3241 bp)
..... aatcaagttataatgtgttaccaggaaagaagggacactgtttggtaaagggcataac .....
position 476 (CDS: 188 - 2221)
NM_001197295.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens extracellular matrix protein 2, female organ and adipocyte specific (ECM2), transcript variant 3, mRNA. (2656 bp)
..... aatcaagttataatgtgttaccaggaaagaagggacactgtttggtaaagggcataac .....
position 476 (CDS: 188 - 2119)
NM_001197296.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens S100P binding protein (S100PBP), transcript variant 3, mRNA. (4356 bp)
..... ctagttccctacagaaaacccaaggagtgaagggacaggattttgcctaggcaaaaat .....
position 3630 (CDS: 278 - 1504)
Synonym: S100PBPR
NM_001256121.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ubiquitin specific peptidase 43 (USP43), transcript variant 2, mRNA. (4165 bp)
..... atggtaaggcaagattctagcaaagagagatgggagataaatggctgagagttcaggt .....
position 3973 (CDS: 97 - 3453)
NM_001267576.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens exportin 6 (XPO6), transcript variant 1, mRNA. (4640 bp)
..... caccttctcaccattccagccaaggagagatgtgacgttggaactgctctggcacttc .....
position 4428 (CDS: 729 - 4064)
Synonym: EXP6; RANBP20
NM_001270940.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inscuteable homolog (Drosophila) (INSC), transcript variant 3, mRNA. (2856 bp)
..... ctcctggaagcctgcagtgacaagcagagagtggacacgccttacactcgggaccaga .....
position 1207 (CDS: 74 - 1672)
NM_001278313.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inscuteable homolog (Drosophila) (INSC), transcript variant 4, mRNA. (2961 bp)
..... ctcctggaagcctgcagtgacaagcagagagtggacacgccttacactcgggaccaga .....
position 1312 (CDS: 74 - 1777)
NM_001278314.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inscuteable homolog (Drosophila) (INSC), transcript variant 5, mRNA. (2935 bp)
..... ctcctggaagcctgcagtgacaagcagagagtggacacgccttacactcgggaccaga .....
position 1207 (CDS: 74 - 1636)
NM_001278315.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inscuteable homolog (Drosophila) (INSC), transcript variant 6, mRNA. (2730 bp)
..... ctcctggaagcctgcagtgacaagcagagagtggacacgccttacactcgggaccaga .....
position 1081 (CDS: 74 - 1546)
NM_001278316.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 2,4-dienoyl CoA reductase 1, mitochondrial (DECR1), mRNA. (1251 bp)
..... aacgacctgagaaaggtcaccaaggagcagtgggacaccatagaagaactcatcagga .....
position 1095 (CDS: 142 - 1149)
Synonym: DECR; NADPH; SDR18C1
NM_001359.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dihydropyrimidinase (DPYS), mRNA. (2197 bp)
..... agctaaggtgatagcggatgcaaggagagatgggaaggtggtctatggtgaacccata .....
position 911 (CDS: 130 - 1689)
Synonym: DHP; DHPase
NM_001385.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens extracellular matrix protein 2, female organ and adipocyte specific (ECM2), transcript variant 1, mRNA. (3307 bp)
..... aatcaagttataatgtgttaccaggaaagaagggacactgtttggtaaagggcataac .....
position 476 (CDS: 188 - 2287)
NM_001393.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens E1A binding protein p300 (EP300), mRNA. (8761 bp)
..... atcacatgcaacagatgcaacaaggaaatatgggacagataggccagcttccccaggc .....
position 7101 (CDS: 396 - 7640)
Synonym: KAT3B; p300; RSTS2
NM_001429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 (ATP2A2), transcript variant a, mRNA. (4359 bp)
..... ctggaacaggtcaagaagcttaaggagagatggggctccaacgagttaccggctgaag .....
position 659 (CDS: 564 - 3557)
Synonym: ATP2B; DAR; DD; SERCA2
NM_001681.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type IV, alpha 1 (COL4A1), mRNA. (6549 bp)
..... tgaagggccagaaaggagaccaaggagagaaaggacaaattggaccaattggtgagaa ..... ttgacggtgcccctggccagaaaggagagatgggacctgccgggcctactggtccaag .....
position 2979 4341 (CDS: 123 - 5132)
Synonym: arresten; HANAC; ICH; POREN1
NM_001845.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type IX, alpha 1 (COL9A1), transcript variant 1, mRNA. (3805 bp)
..... aaccgggccaacaggggcctccaggagaggtgggaccccgaggaccccaggggcttcc .....
position 1993 (CDS: 160 - 2925)
Synonym: DJ149L1.1.2; EDM6; MED; STL4
NM_001851.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type XVI, alpha 1 (COL16A1), mRNA. (5584 bp)
..... ctccgggccgtgatgggcagcaaggacagacgggactcagaggaacaccaggtgaaaa .....
position 2919 (CDS: 366 - 5180)
Synonym: 447AA; FP1572
NM_001856.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 1, mRNA. (6476 bp)
..... aaattgtagactgtagagccccaggagagctggaacacgggctgatcaccttctctac .....
position 1498 (CDS: 391 - 2490)
Synonym: 3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF
NM_001879.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), transcript variant 1, mRNA. (6734 bp)
..... ttgaaaccttatgattttcccaaggggagatgggacagtgtcatctaaatattccgaa .....
position 3730 (CDS: 113 - 2854)
Synonym: PTP-H1; PTPH1
NM_002829.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens nuclear receptor coactivator 1 (NCOA1), transcript variant 1, mRNA. (6895 bp)
..... cagacatgaaggcctggcagcaaggagcgataggaaacaacaatgtgttcagtcaagc .....
position 4117 (CDS: 259 - 4584)
Synonym: bHLHe42; bHLHe74; F-SRC-1; KAT13A; RIP160; SRC1
NM_003743.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens guanylate binding protein 2, interferon-inducible (GBP2), mRNA. (4148 bp)
..... atggcatgctggctgcaaataaaggagatctgggacacttaactaggcttttaaagta .....
position 2623 (CDS: 315 - 2090)
NM_004120.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phosphate cytidylyltransferase 1, choline, beta (PCYT1B), transcript variant 1, mRNA. (5564 bp)
..... tttagcatctagtcataccccagggagagatgcgagacggtgtcactggctcagctga .....
position 5098 (CDS: 234 - 1343)
Synonym: CCTB; CTB
NM_004845.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neuropeptide FF receptor 2 (NPFFR2), transcript variant 1, mRNA. (2056 bp)
..... cgccgggagaggttcatcatgaatgagaaatgggacacaaactcttcagaaaactggc .....
position 407 (CDS: 99 - 1667)
Synonym: GPR74; HLWAR77; NPFF2; NPGPR
NM_004885.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD8b molecule (CD8B), transcript variant 5, mRNA. (1433 bp)
..... gtaacgagcacgatgtggaaaaatgagagaagggacacattcaaccctggagagttca .....
position 759 (CDS: 60 - 692)
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_004931.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens G protein-coupled receptor 37 (endothelin receptor type B-like) (GPR37), mRNA. (3815 bp)
..... cagcgatcttttttactggccaaggagagccgggaaactccagggttcccaccacaag .....
position 1597 (CDS: 1050 - 2891)
Synonym: EDNRBL; hET(B)R-LP; PAELR
NM_005302.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chemokine (C-C motif) ligand 8 (CCL8), mRNA. (1351 bp)
..... aaggaggtctgtgctgaccccaaggagagatgggtcagggattccatgaagcatctgg .....
position 689 (CDS: 456 - 755)
Synonym: HC14; MCP-2; MCP2; SCYA10; SCYA8
NM_005623.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin, heavy chain 1, skeletal muscle, adult (MYH1), mRNA. (6038 bp)
..... agacagacatttcccaaatccagggagagatggaagacatcatccaggaagcccgcaa .....
position 5318 (CDS: 95 - 5914)
Synonym: MYHa; MyHC-2x; MyHC-2X/D; MYHSA1
NM_005963.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens emopamil binding protein (sterol isomerase) (EBP), mRNA. (1191 bp)
..... agcaccgcgacggattccagcacggagagctgggccaccctctctacttctggtttta .....
position 731 (CDS: 206 - 898)
Synonym: CDPX2; CHO2; CPX; CPXD
NM_006579.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calpain 9 (CAPN9), transcript variant 1, mRNA. (2362 bp)
..... ccaccaggactgatatctgccagggagagctgggagactgctggctattagccgccat .....
position 384 (CDS: 114 - 2186)
Synonym: GC36; nCL-4
NM_006615.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens BTG family, member 2 (BTG2), mRNA. (2718 bp)
..... tgttagggggtagacctagccaaggagaagtgggagacgtttggctagcaccccagga .....
position 841 (CDS: 72 - 548)
Synonym: PC3; TIS21
NM_006763.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, T (PTPRT), transcript variant 2, mRNA. (12644 bp)
..... tgggacagcatgccactgagcaaggagagatgggtgagcctgaagatggtccctttgg .....
position 5569 (CDS: 185 - 4510)
Synonym: RPTPrho
NM_007050.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens adenylate kinase 5 (AK5), transcript variant 2, mRNA. (3937 bp)
..... aaggaactgggtggctgtgacaaggtgaaatgggatacatttgtaagccaggaaaaga .....
position 1104 (CDS: 1027 - 2637)
Synonym: AK6
NM_012093.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 (HECW1), mRNA. (6839 bp)
..... ttcccagtccagcttagatctaaggagagaggggtcactttctccagtgaactcacaa .....
position 3400 (CDS: 606 - 5426)
Synonym: NEDL1
NM_015052.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens exportin 6 (XPO6), transcript variant 2, mRNA. (4504 bp)
..... caccttctcaccattccagccaaggagagatgtgacgttggaactgctctggcacttc .....
position 4292 (CDS: 551 - 3928)
Synonym: EXP6; RANBP20
NM_015171.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens non-SMC condensin I complex, subunit H (NCAPH), mRNA. (4495 bp)
..... aaaaccagctcaggagacgccaaggaaagatgggacctcccggcccagcactgccagc .....
position 76 (CDS: 85 - 2310)
Synonym: BRRN1; CAP-H; HCAP-H
NM_015341.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protection of telomeres 1 (POT1), transcript variant 1, mRNA. (4095 bp)
..... ttttttagcttcttcatctacaagcagagatggtaaaccttgcatatttttgaaagca .....
position 498 (CDS: 602 - 2506)
Synonym: HPOT1
NM_015450.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GINS complex subunit 2 (Psf2 homolog) (GINS2), mRNA. (1196 bp)
..... gacgaaatccggaccctggtcaaggatatgtgggacactcgtatagccaaactccgag .....
position 435 (CDS: 85 - 642)
Synonym: HSPC037; Pfs2; PSF2
NM_016095.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AT rich interactive domain 4B (RBP1-like) (ARID4B), transcript variant 1, mRNA. (6067 bp)
..... cctgctggttttgggggggagaaggagagaggggactctggacgtgccagggtcagat .....
position 396 (CDS: 499 - 4437)
Synonym: BCAA; BRCAA1; RBBP1L1; RBP1L1; SAP180
NM_016374.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calpain 9 (CAPN9), transcript variant 2, mRNA. (2484 bp)
..... ccaccaggactgatatctgccagggagagctgggagactgctggctattagccgccat .....
position 353 (CDS: 83 - 2077)
Synonym: GC36; nCL-4
NM_016452.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin, heavy chain 2, skeletal muscle, adult (MYH2), transcript variant 1, mRNA. (6163 bp)
..... agacagatatttcccaaatgcaaggagagatggaggacattctccaggaagcccgcaa .....
position 5358 (CDS: 129 - 5954)
Synonym: MYH2A; MYHas8; MyHC-2A; MyHC-IIa; MYHSA2
NM_017534.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens INO80 complex subunit D (INO80D), mRNA. (14136 bp)
..... gtttgtaatttccctttaaacaagaagagatggctcacattttccatatatatctcaa .....
position 13847 (CDS: 406 - 3489)
NM_017759.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WD repeat domain 6 (WDR6), mRNA. (4273 bp)
..... cggtacctgctgcccccaagcaagcagagatggcacacatgcagtgccttcctacccc .....
position 1695 (CDS: 139 - 3594)
NM_018031.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens acylglycerol kinase (AGK), mRNA. (2925 bp)
..... cacggatgtgatcattgttgcaggaggagatgggacactgcaggaggttgttactggt .....
position 536 (CDS: 172 - 1440)
Synonym: CATC5; MTDPS10; MULK
NM_018238.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lysine (K)-specific demethylase 3A (KDM3A), transcript variant 1, mRNA. (4907 bp)
..... cattccactgcccgagtacacaaggcgagatggcaaactgaatttggcctctaggctg .....
position 3551 (CDS: 328 - 4293)
Synonym: JHDM2A; JHMD2A; JMJD1; JMJD1A; TSGA
NM_018433.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin alpha subfamily C, 1 (PCDHAC1), transcript variant 1, mRNA. (5475 bp)
..... actccctaagcaacagcacgcaagcagagctgcgacaccgctttcacgtgcaccctaa .....
position 1005 (CDS: 177 - 3068)
Synonym: PCDH-ALPHA-C1
NM_018898.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PR domain containing 8 (PRDM8), transcript variant 1, mRNA. (4118 bp)
..... agcctcgctagaggaatgtgcaaggacagaagggaaactgaggagacccgcaactcat .....
position 114 (CDS: 1232 - 3301)
Synonym: PFM5
NM_020226.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens alpha-kinase 3 (ALPK3), mRNA. (10936 bp)
..... gatacaagtggatggaaggaccaggggagatggaacacagacagcccagaggacacgt .....
position 2638 (CDS: 168 - 5891)
Synonym: MAK; MIDORI
NM_020778.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type XX, alpha 1 (COL20A1), mRNA. (4187 bp)
..... ccaggggtccaccaggggtcaaaggagagaagggagaccatgggcttccaggcttgca .....
position 3410 (CDS: 101 - 3955)
Synonym: bA261N11.4
NM_020882.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myotubularin related protein 3 (MTMR3), transcript variant 3, mRNA. (9008 bp)
..... acattcctgtgcaacaacgccaaggagagaggggaaaagcatactcaggaacggacat .....
position 1891 (CDS: 329 - 3925)
Synonym: FYVE-DSP1; ZFYVE10
NM_021090.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 204, member A (FAM204A), transcript variant 1, mRNA. (2766 bp)
..... cttgcatgggggtttgaagcaaagaagagatgggaaaccaaaagcaacatgggataca .....
position 927 (CDS: 268 - 969)
Synonym: bA319I23.1; C10orf84; RP11-319I23.1
NM_022063.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens popeye domain containing 2 (POPDC2), mRNA. (1667 bp)
..... cccactggaaggctcacaggcaaggtgagagaggacacagaaggtgccaacactgtcg .....
position 1336 (CDS: 135 - 1229)
Synonym: POP2
NM_022135.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens S100P binding protein (S100PBP), transcript variant 1, mRNA. (4370 bp)
..... ctagttccctacagaaaacccaaggagtgaagggacaggattttgcctaggcaaaaat .....
position 3644 (CDS: 292 - 1518)
Synonym: S100PBPR
NM_022753.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptopodin 2-like (SYNPO2L), transcript variant 2, mRNA. (4131 bp)
..... acaggcacaggtcccaggaccaaggagaggtggaacatccagttcctaaagttgcttc .....
position 2305 (CDS: 23 - 2284)
NM_024875.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AT rich interactive domain 4B (RBP1-like) (ARID4B), transcript variant 2, mRNA. (5809 bp)
..... cctgctggttttgggggggagaaggagagaggggactctggacgtgccagggtcagat .....
position 396 (CDS: 499 - 4179)
Synonym: BCAA; BRCAA1; RBBP1L1; RBP1L1; SAP180
NM_031371.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin alpha subfamily C, 1 (PCDHAC1), transcript variant 2, mRNA. (2796 bp)
..... actccctaagcaacagcacgcaagcagagctgcgacaccgctttcacgtgcaccctaa .....
position 1005 (CDS: 177 - 2633)
Synonym: PCDH-ALPHA-C1
NM_031882.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type XXVII, alpha 1 (COL27A1), mRNA. (5583 bp)
..... cccaggggccaattgggcctccaggagagatgggacccaaggggccgcctggtgcagt .....
position 3427 (CDS: 1 - 5583)
Synonym: RP11-82I1.1
NM_032888.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens spectrin repeat containing, nuclear envelope 1 (SYNE1), transcript variant 2, mRNA. (27439 bp)
..... aaacagatggttcacgaaggcaaccagagatgggacaacctgcaaaagcgtgtcacct .....
position 24479 (CDS: 438 - 26687)
Synonym: 8B; ARCA1; C6orf98; CPG2; dJ45H2.2; EDMD4; MYNE1; Nesp1; SCAR8
NM_033071.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tripartite motif containing 15 (TRIM15), mRNA. (2241 bp)
..... ccggggagggggtgaggaggaagggagagatgggactcagcgccgaggacggcgtctg .....
position 1602 (CDS: 480 - 1877)
Synonym: RNF93; ZNF178; ZNFB7
NM_033229.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neuropeptide FF receptor 2 (NPFFR2), transcript variant 2, mRNA. (1941 bp)
..... ccatattacaggttcatcatgaatgagaaatgggacacaaactcttcagaaaactggc .....
position 292 (CDS: 290 - 1552)
Synonym: GPR74; HLWAR77; NPFF2; NPGPR
NM_053036.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type IX, alpha 1 (COL9A1), transcript variant 2, mRNA. (3073 bp)
..... aaccgggccaacaggggcctccaggagaggtgggaccccgaggaccccaggggcttcc .....
position 1261 (CDS: 157 - 2193)
Synonym: DJ149L1.1.2; EDM6; MED; STL4
NM_078485.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aquaporin 10 (AQP10), mRNA. (1794 bp)
..... tcggtgctgtgtcgttcattcaaggagagttgagatacagtgaaatgagccagggcga .....
position 1553 (CDS: 41 - 946)
Synonym: AQPA_HUMAN
NM_080429.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, T (PTPRT), transcript variant 1, mRNA. (12701 bp)
..... tgggacagcatgccactgagcaaggagagatgggtgagcctgaagatggtccctttgg .....
position 5626 (CDS: 185 - 4567)
Synonym: RPTPrho
NM_133170.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein phosphatase 1, regulatory subunit 18 (PPP1R18), transcript variant 1, mRNA. (4615 bp)
..... ctcgggactggaggcaaagcccaggagaggtgggagacaggagctcccgactgtcaga .....
position 2403 (CDS: 1878 - 3719)
Synonym: HKMT1098; KIAA1949
NM_133471.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. (4184 bp)
..... aaattgtagactgtagagccccaggagagctggaacacgggctgatcaccttctctac .....
position 1498 (CDS: 391 - 2577)
Synonym: 3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF
NM_139125.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens nuclear receptor coactivator 1 (NCOA1), transcript variant 2, mRNA. (6952 bp)
..... cagacatgaaggcctggcagcaaggagcgataggaaacaacaatgtgttcagtcaagc .....
position 4117 (CDS: 259 - 4458)
Synonym: bHLHe42; bHLHe74; F-SRC-1; KAT13A; RIP160; SRC1
NM_147223.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens nuclear receptor coactivator 1 (NCOA1), transcript variant 3, mRNA. (6892 bp)
..... cagacatgaaggcctggcagcaaggagcgataggaaacaacaatgtgttcagtcaagc .....
position 4117 (CDS: 259 - 4581)
Synonym: bHLHe42; bHLHe74; F-SRC-1; KAT13A; RIP160; SRC1
NM_147233.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens germinal center-associated, signaling and motility (GCSAM), transcript variant 1, mRNA. (3349 bp)
..... gtgggatgggggatctgcctgaagcagggatgggacacaaagtccctccagcttatct .....
position 787 (CDS: 186 - 722)
Synonym: GCAT2; GCET2; HGAL
NM_152785.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type XXII, alpha 1 (COL22A1), mRNA. (6366 bp)
..... gtgcacctggagttggcctccgaggcgagatgggaccccctggaatcccaggtcaacc .....
position 5110 (CDS: 448 - 5328)
NM_152888.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phospholipase B1 (PLB1), transcript variant 1, mRNA. (5148 bp)
..... caaaacacactcaccccactgaacgagagaggggacactgacctcaccttcttctccg .....
position 4040 (CDS: 45 - 4421)
Synonym: hPLB; PLB; PLB/LIP
NM_153021.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myotubularin related protein 3 (MTMR3), transcript variant 1, mRNA. (8924 bp)
..... acattcctgtgcaacaacgccaaggagagaggggaaaagcatactcaggaacggacat .....
position 1891 (CDS: 329 - 3841)
Synonym: FYVE-DSP1; ZFYVE10
NM_153050.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myotubularin related protein 3 (MTMR3), transcript variant 2, mRNA. (8897 bp)
..... acattcctgtgcaacaacgccaaggagagaggggaaaagcatactcaggaacggacat .....
position 1891 (CDS: 329 - 3814)
Synonym: FYVE-DSP1; ZFYVE10
NM_153051.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ubiquitin specific peptidase 43 (USP43), transcript variant 1, mRNA. (4180 bp)
..... atggtaaggcaagattctagcaaagagagatgggagataaatggctgagagttcaggt .....
position 3988 (CDS: 97 - 3468)
NM_153210.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GTPase, IMAP family member 7 (GIMAP7), mRNA. (1242 bp)
..... actccagggctctttgacaccaaggagagcctggacaccacctgcaaggaaatcagcc .....
position 340 (CDS: 131 - 1033)
Synonym: hIAN7; IAN7
NM_153236.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 (ATP2A2), transcript variant b, mRNA. (8329 bp)
..... ctggaacaggtcaagaagcttaaggagagatggggctccaacgagttaccggctgaag .....
position 659 (CDS: 564 - 3692)
Synonym: ATP2B; DAR; DD; SERCA2
NM_170665.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens adenylate kinase 5 (AK5), transcript variant 1, mRNA. (3326 bp)
..... aaggaactgggtggctgtgacaaggtgaaatgggatacatttgtaagccaggaaaaga .....
position 493 (CDS: 338 - 2026)
Synonym: AK6
NM_174858.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens spectrin repeat containing, nuclear envelope 1 (SYNE1), transcript variant 1, mRNA. (27748 bp)
..... aaacagatggttcacgaaggcaaccagagatgggacaacctgcaaaagcgtgtcacct .....
position 24857 (CDS: 603 - 26996)
Synonym: 8B; ARCA1; C6orf98; CPG2; dJ45H2.2; EDMD4; MYNE1; Nesp1; SCAR8
NM_182961.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dedicator of cytokinesis 8 (DOCK8), transcript variant 1, mRNA. (7470 bp)
..... agattgaaaaagtcctgcagcagggagagattggagactgtgcagagccctacacggt .....
position 1175 (CDS: 113 - 6412)
Synonym: MRD2; ZIR8
NM_203447.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens BEN domain containing 4 (BEND4), transcript variant 1, mRNA. (8850 bp)
..... ggatgaggctgtaaattcttcaaagaaagatgggagacggctccttcgatacctcatc .....
position 1800 (CDS: 581 - 2185)
Synonym: CCDC4
NM_207406.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB9B, member RAS oncogene family pseudogene 1 (RAB9BP1), non-coding RNA. (625 bp)
..... gtggatggacattttggtaccaagtagaattgggacacagcaggtcaggagtgattct .....
position 171
Synonym: RAB9P1
NR_000039.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protection of telomeres 1 (POT1), transcript variant 2, non-coding RNA. (4215 bp)
..... ttttttagcttcttcatctacaagcagagatggtaaaccttgcatatttttgaaagca .....
position 498
Synonym: HPOT1
NR_003102.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protection of telomeres 1 (POT1), transcript variant 3, non-coding RNA. (4006 bp)
..... ttttttagcttcttcatctacaagcagagatggtaaaccttgcatatttttgaaagca .....
position 498
Synonym: HPOT1
NR_003103.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protection of telomeres 1 (POT1), transcript variant 5, non-coding RNA. (4192 bp)
..... ttttttagcttcttcatctacaagcagagatggtaaaccttgcatatttttgaaagca .....
position 498
Synonym: HPOT1
NR_003104.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), transcript variant 7, non-coding RNA. (5504 bp)
..... ttgaaaccttatgattttcccaaggggagatgggacagtgtcatctaaatattccgaa .....
position 2500
Synonym: PTP-H1; PTPH1
NR_026918.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MRGPRG antisense RNA 1 (MRGPRG-AS1), non-coding RNA. (1790 bp)
..... gacaagtgtccctatacaggaaaggagaggagggacactggagagcagggggaggcca .....
position 1568
Synonym: C11orf36; HSD-40
NR_027138.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens gametogenetin binding protein 1 (pseudogene) (GGNBP1), non-coding RNA. (999 bp)
..... agtgcctgcttcttgaggagaaaggtgagatgggaaactggcctccagagtga
position 967
NR_028361.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 4, non-coding RNA. (3952 bp)
..... aaattgtagactgtagagccccaggagagctggaacacgggctgatcaccttctctac .....
position 1266
Synonym: 3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF
NR_033519.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC440600 (LOC440600), non-coding RNA. (2671 bp)
..... tatgattggtgtccttataaaaaggagaaattggacacagacaccctaccaagaagaa .....
position 448
NR_036595.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC100507140 (LOC100507140), non-coding RNA. (2050 bp)
..... aagtgtcaaagtcatgatgtcaaagagagaggggagacctgattcctgctccaggaca .....
position 76
NR_037886.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC401281 (FLJ27255), misc_RNA. (2002 bp)
..... gctcagtgcggagctgggttcaaggagagctggggctctgaaggagtcgtggggagaa .....
position 1260
XR_159021.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC401281 (FLJ27255), misc_RNA. (2002 bp)
..... gctcagtgcggagctgggttcaaggagagctggggctctgaaggagtcgtggggagaa .....
position 1260
XR_159472.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC401281 (FLJ27255), misc_RNA. (2002 bp)
..... gctcagtgcggagctgggttcaaggagagctggggctctgaaggagtcgtggggagaa .....
position 1260
XR_171608.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.012 | 0.012 | q_start
0.289 | 0.277 | q_end
2.409 | 2.120 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.