GGRNA Home | Help | Advanced search

2018-08-18 22:52:29, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
seq2:caagaagagattgcc340 NM_000034, NM_000119, NM_000167, NM_000259, NM_000523, NM_000593, NM_000721, NM_000833, NM_000845, NM_000888, NM_001001971, NM_001002006, NM_001002920, NM_001005365, NM_001008224, [...]
[AND] 340 NM_000034, NM_000119, NM_000167, NM_000259, NM_000523, NM_000593, NM_000721, NM_000833, NM_000845, NM_000888, NM_001001971, NM_001002006, NM_001002920, NM_001005365, NM_001008224, [...]


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 1, mRNA. (2408 bp)
..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....
position 1823 (CDS: 1088 - 2182)
Synonym: ALDA; GSD12
NM_000034.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens erythrocyte membrane protein band 4.2 (EPB42), transcript variant 1, mRNA. (2554 bp)
..... ccaaccttagctgctttgctcaggaagacattgccatttgtagaccacaccttgc .....
position 2128 (CDS: 301 - 2466)
Synonym: PA; SPH5
NM_000119.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glycerol kinase (GK), transcript variant 2, mRNA. (4485 bp)
..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....
position 3199 (CDS: 180 - 1754)
Synonym: GK1; GKD
NM_000167.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin VA (heavy chain 12, myoxin) (MYO5A), transcript variant 1, mRNA. (12238 bp)
..... ctgggcgggtccttagtctgcaggaagaaattgccaagctccggaaagacctgga .....
position 3209 (CDS: 245 - 5812)
Synonym: GS1; MYH12; MYO5; MYR12
NM_000259.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens homeobox D13 (HOXD13), mRNA. (2341 bp)
..... tgcgtctaccgaagagggaggaagaagagagtgccttacaccaaactgcagctta .....
position 918 (CDS: 88 - 1119)
Synonym: BDE; BDSD; HOX4I; SPD
NM_000523.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (TAP1), mRNA. (2974 bp)
..... aggtatttggaagaagtcttcaagaaaatattgcctatggcctgacccagaagcc .....
position 2121 (CDS: 156 - 2582)
Synonym: ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1*0102N; TAP1N
NM_000593.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 3, mRNA. (14972 bp)
..... gtgccaaggagccaacgatccaagaagagagagcccaggatttaaggaggaccaa .....
position 3115 (CDS: 196 - 7008)
Synonym: BII; CACH6; CACNL1A6; Cav2.3
NM_000721.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 2, mRNA. (14468 bp)
..... taaagagccctaggtatcttccagaagagatggcccactctgacatttcagaaac .....
position 3467 (CDS: 311 - 4705)
Synonym: EPND; GluN2A; NMDAR2A; NR2A
NM_000833.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 1, mRNA. (3572 bp)
..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatttt .....
position 1272 (CDS: 312 - 3038)
Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NM_000845.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens integrin, beta 6 (ITGB6), mRNA. (2397 bp)
..... cccctttcgtgaaaacaacaccagaagaaattgccaacccttgcagtagtattcc .....
position 584 (CDS: 17 - 2383)
NM_000888.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 2, mRNA. (3101 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....
position 1412 (CDS: 135 - 1598)
Synonym: FAM13C1
NM_001001971.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 1, mRNA. (2898 bp)
..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....
position 1430 (CDS: 113 - 1945)
Synonym: AIRP; CN-IB; CN1B
NM_001002006.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens POTE ankyrin domain family, member A (POTEA), transcript variant 1, mRNA. (1838 bp)
..... tgcatgaaaatagcatgatgcaggaagaaattgccatgctaagaatagaactaga .....
position 1658 (CDS: 44 - 1402)
Synonym: A26A1; CT104.3; POTE-8; POTE8
NM_001002920.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens POTE ankyrin domain family, member A (POTEA), transcript variant 2, mRNA. (1976 bp)
..... tgcatgaaaatagcatgatgcaggaagaaattgccatgctaagaatagaactaga .....
position 1796 (CDS: 44 - 1540)
Synonym: A26A1; CT104.3; POTE-8; POTE8
NM_001005365.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 2, mRNA. (7096 bp)
..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaattaa .....
position 3196 (CDS: 367 - 4578)
Synonym: NUCLING
NM_001008224.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 793 (ZNF793), mRNA. (7136 bp)
..... aggccaggcgcagccataagcaagaaaacattgcccaaggagaaaagctgtgaat .....
position 754 (CDS: 443 - 1663)
NM_001013659.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens forkhead box K1 (FOXK1), mRNA. (11191 bp)
..... cttcaatccgggctgacagccaagaagagttttcctcccttcggtgacagggcct .....
position 9724 (CDS: 11 - 2212)
Synonym: FOXK1L
NM_001037165.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 2, mRNA. (3532 bp)
..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgcaag .....
position 1319 (CDS: 170 - 3379)
Synonym: FAM42A; HsT19294; RIA1
NM_001040610.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 5, mRNA. (8257 bp)
..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....
position 4945 (CDS: 104 - 4612)
NM_001040712.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant beta, mRNA. (6910 bp)
..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....
position 4009 (CDS: 409 - 4869)
Synonym: FAM68A; KAB; KIAA0470
NM_001042404.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant gamma, mRNA. (6832 bp)
..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....
position 3901 (CDS: 409 - 4791)
Synonym: FAM68A; KAB; KIAA0470
NM_001042405.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 1, mRNA. (7653 bp)
..... gtaagataatagacagccaacaagatgagattgacagaatgattttagaaattca .....
position 2467 (CDS: 589 - 3006)
Synonym: bA57K17.2; C6orf204; NY-BR-15; RP11-57K17.2
NM_001042475.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cortexin 3 (CTXN3), transcript variant 1, mRNA. (1683 bp)
..... tatgaatctggtgacaaggccaggaagagatttccttgctctaattatgtctata .....
position 1194 (CDS: 575 - 820)
Synonym: KABE
NM_001048252.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 2, mRNA. (3302 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1067 (CDS: 566 - 2554)
Synonym: MS4A16; NYD-SP21
NM_001079692.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 2, mRNA. (3380 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....
position 1137 (CDS: 183 - 2426)
Synonym: CALCOCO3; T6BP; TXBP151
NM_001079864.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens KIAA1217 (KIAA1217), transcript variant 2, mRNA. (6142 bp)
..... gcagagagaacttgtttatgcaagaggagatggccctggggcccctcgccccgga .....
position 1438 (CDS: 810 - 4604)
Synonym: RP11-324E23.1; SKT
NM_001098500.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens KIAA1217 (KIAA1217), transcript variant 3, mRNA. (5871 bp)
..... gcagagagaacttgtttatgcaagaggagatggccctggggcccctcgccccgga .....
position 1272 (CDS: 404 - 4333)
Synonym: RP11-324E23.1; SKT
NM_001098501.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sarcalumenin (SRL), mRNA. (4219 bp)
..... cccatcaggaactgttcctccaagaagagatctccctcctagaagacctgaatca .....
position 938 (CDS: 14 - 1435)
NM_001098814.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 1, mRNA. (6797 bp)
..... tccaaccttggcccctctgacaagaagagcttcccaatcatctctggaaagttca .....
position 4128 (CDS: 140 - 4189)
Synonym: OBOE; RAB3IP3; RIM2
NM_001100117.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, beta (ACTB), mRNA. (1852 bp)
..... aacctaacttgcgcagaaaacaagatgagattggcatggctttatttgttttttt .....
position 1273 (CDS: 85 - 1212)
Synonym: BRWS1; PS1TP5BP1
NM_001101.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 1, mRNA. (7376 bp)
..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggc .....
position 4938 (CDS: 399 - 5870)
Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_001105206.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 3, mRNA. (7372 bp)
..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggc .....
position 4934 (CDS: 416 - 5866)
Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_001105207.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Janus kinase and microtubule interacting protein 3 (JAKMIP3), mRNA. (6488 bp)
..... acaccgatactagaagtcaaaaagaagagagtgcccaagtgtgggtttggaggca .....
position 6013 (CDS: 1 - 2535)
Synonym: bA140A10.5; C10orf14; C10orf39; Jamip3; NECC2
NM_001105521.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens erythrocyte membrane protein band 4.2 (EPB42), transcript variant 2, mRNA. (2464 bp)
..... ccaaccttagctgctttgctcaggaagacattgccatttgtagaccacaccttgc .....
position 2038 (CDS: 301 - 2376)
Synonym: PA; SPH5
NM_001114134.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 2, mRNA. (3873 bp)
..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatttt .....
position 1518 (CDS: 558 - 3284)
Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NM_001127323.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cortexin 3 (CTXN3), transcript variant 2, mRNA. (1492 bp)
..... tatgaatctggtgacaaggccaggaagagatttccttgctctaattatgtctata .....
position 1003 (CDS: 384 - 629)
Synonym: KABE
NM_001127385.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 4, mRNA. (1630 bp)
..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....
position 1045 (CDS: 310 - 1404)
Synonym: ALDA; GSD12
NM_001127617.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glycerol kinase (GK), transcript variant 3, mRNA. (4572 bp)
..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....
position 3286 (CDS: 180 - 1841)
Synonym: GK1; GKD
NM_001128127.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 2, mRNA. (3662 bp)
..... aagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaa .....
position 1382 (CDS: 458 - 2578)
Synonym: BCL5; BCL6A; LAZ3; ZBTB27; ZNF51
NM_001130845.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 1, mRNA. (14706 bp)
..... taaagagccctaggtatcttccagaagagatggcccactctgacatttcagaaac .....
position 3705 (CDS: 549 - 4943)
Synonym: EPND; GluN2A; NMDAR2A; NR2A
NM_001134407.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 3, mRNA. (4745 bp)
..... taaagagccctaggtatcttccagaagagatggcccactctgacatttcagaaac .....
position 3366 (CDS: 210 - 4055)
Synonym: EPND; GluN2A; NMDAR2A; NR2A
NM_001134408.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens derlin 1 (DERL1), transcript variant 2, mRNA. (3284 bp)
..... cccaacccccacatttgcaactagaagaggttgcccataaaattgctctgccctt .....
position 1415 (CDS: 302 - 997)
Synonym: DER-1; DER1
NM_001134671.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 3, mRNA. (3086 bp)
..... aagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaa .....
position 974 (CDS: 50 - 2002)
Synonym: BCL5; BCL6A; LAZ3; ZBTB27; ZNF51
NM_001134738.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens POTE ankyrin domain family, member C (POTEC), mRNA. (2243 bp)
..... tgcgtgaaaacagcatgttgcaggaagaaattgccatgctaatttctggagactg .....
position 2042 (CDS: 455 - 2083)
Synonym: A26B2; CT104.6; POTE-18; POTE18
NM_001137671.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin VA (heavy chain 12, myoxin) (MYO5A), transcript variant 2, mRNA. (12157 bp)
..... ctgggcgggtccttagtctgcaggaagaaattgccaagctccggaaagacctgga .....
position 3209 (CDS: 245 - 5731)
Synonym: GS1; MYH12; MYO5; MYR12
NM_001142495.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 3, mRNA. (3566 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....
position 1877 (CDS: 555 - 2063)
Synonym: FAM13C1
NM_001143773.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leupaxin (LPXN), transcript variant 1, mRNA. (1892 bp)
..... attttgtctgtactcattgcaaagaagagattggctccagtcccttctttgagcg .....
position 679 (CDS: 121 - 1296)
Synonym: LDPL
NM_001143995.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens stomatin (EPB72)-like 3 (STOML3), transcript variant 2, mRNA. (2020 bp)
..... tgtcccagatcttagctggacgagaagagatcgcccatagcatccagactttact .....
position 712 (CDS: 250 - 1098)
Synonym: Epb7.2l; SRO
NM_001144033.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inositol(myo)-1(or 4)-monophosphatase 1 (IMPA1), transcript variant 2, mRNA. (3597 bp)
..... aaaaactacaagtttcacaacaagaagatattaccaaatctctcttggtgactga .....
position 779 (CDS: 152 - 1162)
Synonym: IMP; IMPA
NM_001144878.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 2, mRNA. (7037 bp)
..... acagtcacccatgttagccacaagaagaggttggctgtttatggtttgcacagtg .....
position 5851 (CDS: 208 - 2136)
Synonym: EF-1a; ERFS; HBS1; HSPC276
NM_001145158.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 3, mRNA. (8957 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....
position 891 (CDS: 192 - 2597)
Synonym: HSSOX6; SOXD
NM_001145811.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 4, mRNA. (8919 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....
position 772 (CDS: 34 - 2559)
Synonym: HSSOX6; SOXD
NM_001145819.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 2, mRNA. (2851 bp)
..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....
position 1597 (CDS: 292 - 1893)
Synonym: KIAA1018; KMIN; MTMR15
NM_001146094.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 3, mRNA. (2748 bp)
..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....
position 1494 (CDS: 189 - 1790)
Synonym: KIAA1018; KMIN; MTMR15
NM_001146095.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 4, mRNA. (2864 bp)
..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....
position 1610 (CDS: 305 - 1906)
Synonym: KIAA1018; KMIN; MTMR15
NM_001146096.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RNA binding motif protein, X-linked-like 1 (RBMXL1), transcript variant 1, mRNA. (5128 bp)
..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatacaaga .....
position 1378 (CDS: 717 - 1889)
Synonym: RBM1
NM_001162536.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA. (6269 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....
position 4865 (CDS: 245 - 6070)
Synonym: UNQ2430
NM_001164315.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 1, mRNA. (3065 bp)
..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....
position 139 (CDS: 342 - 2054)
Synonym: 39K2; 39K3
NM_001164380.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 2, mRNA. (2934 bp)
..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....
position 139 (CDS: 307 - 1923)
Synonym: 39K2; 39K3
NM_001164381.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 3, mRNA. (2888 bp)
..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....
position 139 (CDS: 363 - 1877)
Synonym: 39K2; 39K3
NM_001164382.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TLC domain containing 2 (TLCD2), mRNA. (5901 bp)
..... tgcagaggttaaaaaaaaaaaaagcagagattgccagatgctccatttggtagga .....
position 5633 (CDS: 127 - 921)
NM_001164407.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 2, mRNA. (3418 bp)
..... ctaggtcggcgcccgatcggcaagaagagattagcaaattgatgcgaagtgcaag .....
position 1167 (CDS: 42 - 2519)
Synonym: EIF2C2; Q10
NM_001164623.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 2, mRNA. (2071 bp)
..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....
position 547 (CDS: 211 - 801)
NM_001164803.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 2, mRNA. (3870 bp)
..... tgatgccacgcttcgctgaacaagtagaggttgccattgaagccctgagtgccaa .....
position 2041 (CDS: 280 - 2862)
Synonym: CAP-R; CAPR; CT114; CTNR
NM_001164883.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 3, mRNA. (1678 bp)
..... ttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatgga .....
position 393 (CDS: 162 - 1493)
Synonym: ADA2; ADA2A; hADA2; KL04P; TADA2L
NM_001166105.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 1, mRNA. (1680 bp)
..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....
position 535 (CDS: 334 - 972)
Synonym: DEN1; NEDP1; PRSC2
NM_001166340.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 4, mRNA. (3477 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....
position 1788 (CDS: 469 - 1974)
Synonym: FAM13C1
NM_001166698.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 1, mRNA. (2924 bp)
..... gaacacttccgcctgtcaggccagaagagatttcctgacaccacagctggaaacc .....
position 37 (CDS: 888 - 2564)
NM_001168479.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 4, mRNA. (2918 bp)
..... gaacacttccgcctgtcaggccagaagagatttcctgacaccacagctggaaacc .....
position 37 (CDS: 882 - 2558)
NM_001168480.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 5, mRNA. (2805 bp)
..... gaacacttccgcctgtcaggccagaagagatttcctgacaccacagctggaaacc .....
position 37 (CDS: 769 - 2445)
NM_001168485.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 6, mRNA. (8266 bp)
..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....
position 4954 (CDS: 104 - 4621)
NM_001171025.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 3, mRNA. (1834 bp)
..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....
position 689 (CDS: 488 - 1126)
Synonym: DEN1; NEDP1; PRSC2
NM_001172109.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 4, mRNA. (1676 bp)
..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....
position 531 (CDS: 330 - 968)
Synonym: DEN1; NEDP1; PRSC2
NM_001172110.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 5, mRNA. (1693 bp)
..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....
position 548 (CDS: 347 - 985)
Synonym: DEN1; NEDP1; PRSC2
NM_001172111.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 3, mRNA. (8685 bp)
..... cctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatgga .....
position 530 (CDS: 272 - 1840)
NM_001172411.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 2, mRNA. (8635 bp)
..... cctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatgga .....
position 480 (CDS: 216 - 1790)
NM_001172412.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 3, mRNA. (7141 bp)
..... gtaagataatagacagccaacaagatgagattgacagaatgattttagaaattca .....
position 1955 (CDS: 68 - 2494)
Synonym: bA57K17.2; C6orf204; NY-BR-15; RP11-57K17.2
NM_001178035.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 1, mRNA. (2754 bp)
..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....
position 819 (CDS: 71 - 1069)
Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_001184714.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 3, mRNA. (2604 bp)
..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....
position 672 (CDS: 71 - 919)
Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_001184715.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 4, mRNA. (2421 bp)
..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....
position 486 (CDS: 71 - 736)
Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_001184716.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 2, mRNA. (6570 bp)
..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....
position 541 (CDS: 197 - 3268)
NM_001184773.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 3, mRNA. (6540 bp)
..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....
position 541 (CDS: 197 - 3238)
NM_001184774.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 4, mRNA. (6534 bp)
..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....
position 541 (CDS: 197 - 3232)
NM_001184775.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 5, mRNA. (6348 bp)
..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....
position 541 (CDS: 197 - 3046)
NM_001184776.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 6, mRNA. (6345 bp)
..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....
position 541 (CDS: 197 - 3043)
NM_001184777.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 4, mRNA. (3642 bp)
..... gcccctgatgcttcggggccccagaagagatcgccaggagacactgccaaagatg .....
position 177 (CDS: 28 - 867)
Synonym: D1S2223E; HK33; PBD12A; PMP1; PMPI; PXF; PXMP1
NM_001193644.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myeloid leukemia factor 1 (MLF1), transcript variant 4, mRNA. (2538 bp)
..... ttcttctcagaccatgcaagcaagaagagaatggcatgaaatatataaagtgttg .....
position 197 (CDS: 364 - 1263)
NM_001195432.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 3, mRNA. (3621 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....
position 3113 (CDS: 134 - 1705)
Synonym: BT2.2; BTF2
NM_001197237.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 4, mRNA. (1820 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....
position 1291 (CDS: 235 - 1245)
Synonym: BT2.2; BTF2
NM_001197238.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 5, mRNA. (2969 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....
position 2461 (CDS: 112 - 1053)
Synonym: BT2.2; BTF2
NM_001197239.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 6, mRNA. (3470 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....
position 2962 (CDS: 112 - 882)
Synonym: BT2.2; BTF2
NM_001197240.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 1, mRNA. (5496 bp)
..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtacac .....
position 2284 (CDS: 199 - 2253)
Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001197294.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 1, mRNA. (6515 bp)
..... agagtggacactgctgttatcaagcagagagtgccgatcttactcaagtacctag .....
position 5197 (CDS: 623 - 5488)
Synonym: eIF-4G 3; eIF4G 3; eIF4GII
NM_001198801.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 2, mRNA. (6425 bp)
..... agagtggacactgctgttatcaagcagagagtgccgatcttactcaagtacctag .....
position 5107 (CDS: 623 - 5398)
Synonym: eIF-4G 3; eIF4G 3; eIF4GII
NM_001198802.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 3, mRNA. (2847 bp)
..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....
position 1379 (CDS: 113 - 1894)
Synonym: AIRP; CN-IB; CN1B
NM_001199086.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 4, mRNA. (2949 bp)
..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....
position 1481 (CDS: 113 - 1996)
Synonym: AIRP; CN-IB; CN1B
NM_001199087.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 5, mRNA. (2904 bp)
..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....
position 1436 (CDS: 113 - 1951)
Synonym: AIRP; CN-IB; CN1B
NM_001199088.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NT5C1B-RDH14 readthrough (NT5C1B-RDH14), transcript variant 1, mRNA. (2533 bp)
..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....
position 1256 (CDS: 113 - 2065)
NM_001199103.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NT5C1B-RDH14 readthrough (NT5C1B-RDH14), transcript variant 2, mRNA. (2982 bp)
..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....
position 1430 (CDS: 113 - 1921)
NM_001199104.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, gamma 1 (ACTG1), transcript variant 1, mRNA. (2123 bp)
..... caaaaggcggggtcgcaatggaagaagagatcgccgcgctggtcattgacaatgg .....
position 262 (CDS: 259 - 1386)
Synonym: ACT; ACTG; BRWS2; DFNA20; DFNA26
NM_001199954.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glycerol kinase (GK), transcript variant 4, mRNA. (4590 bp)
..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....
position 3304 (CDS: 180 - 1859)
Synonym: GK1; GKD
NM_001205019.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 1, mRNA. (15101 bp)
..... gtgccaaggagccaacgatccaagaagagagagcccaggatttaaggaggaccaa .....
position 3115 (CDS: 196 - 7137)
Synonym: BII; CACH6; CACNL1A6; Cav2.3
NM_001205293.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 2, mRNA. (14915 bp)
..... gtgccaaggagccaacgatccaagaagagagagcccaggatttaaggaggaccaa .....
position 3058 (CDS: 196 - 6951)
Synonym: BII; CACH6; CACNL1A6; Cav2.3
NM_001205294.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 2, mRNA. (6469 bp)
..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....
position 1030 (CDS: 331 - 1515)
Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_001206651.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 3, mRNA. (6445 bp)
..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....
position 1006 (CDS: 331 - 1491)
Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_001206652.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 4, mRNA. (6240 bp)
..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....
position 801 (CDS: 489 - 1286)
Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_001206653.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 3, mRNA. (3383 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....
position 1140 (CDS: 186 - 2429)
Synonym: CALCOCO3; T6BP; TXBP151
NM_001206901.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 4, mRNA. (3192 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....
position 949 (CDS: 466 - 2238)
Synonym: CALCOCO3; T6BP; TXBP151
NM_001206902.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 1, mRNA. (3490 bp)
..... tggtcctaggctcacctaagccagaagagattccccttacttggatacaaccagg .....
position 967 (CDS: 145 - 3084)
Synonym: dJ292B18.2; FTHFSDC1; MTC1THFS; RP1-292B18.2
NM_001242767.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 3, mRNA. (3174 bp)
..... tggtcctaggctcacctaagccagaagagattccccttacttggatacaaccagg .....
position 651 (CDS: 27 - 2768)
Synonym: dJ292B18.2; FTHFSDC1; MTC1THFS; RP1-292B18.2
NM_001242768.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 6, mRNA. (1751 bp)
..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....
position 1166 (CDS: 269 - 1525)
Synonym: ALDA; GSD12
NM_001243177.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript variant 2, mRNA. (3562 bp)
..... ccactcgagcccagcaactggaagaagacattgccctgtttgaggctcagtactt .....
position 1391 (CDS: 32 - 3124)
Synonym: CILD15
NM_001243342.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens small integral membrane protein 22 (SMIM22), transcript variant 1, mRNA. (1032 bp)
..... ttaagttgcagcgtcaaaaacatgaagagattgctttagcaaatatttacccagt .....
position 270 (CDS: 521 - 772)
NM_001253790.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 2, mRNA. (5678 bp)
..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....
position 5313 (CDS: 359 - 3838)
Synonym: TBC; TBC1
NM_001253912.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 3, mRNA. (3344 bp)
..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....
position 2979 (CDS: 707 - 1504)
Synonym: TBC; TBC1
NM_001253913.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 4, mRNA. (2990 bp)
..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....
position 2625 (CDS: 353 - 1150)
Synonym: TBC; TBC1
NM_001253914.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 5, mRNA. (2540 bp)
..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....
position 2175 (CDS: 158 - 700)
Synonym: TBC; TBC1
NM_001253915.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 2, mRNA. (4292 bp)
..... tctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttaca .....
position 1429 (CDS: 300 - 2222)
Synonym: C10orf119; MCM-BP
NM_001256378.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 3, mRNA. (4102 bp)
..... tctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttaca .....
position 1239 (CDS: 629 - 2032)
Synonym: C10orf119; MCM-BP
NM_001256379.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens multiple EGF-like-domains 10 (MEGF10), transcript variant 2, mRNA. (7638 bp)
..... tgtggagatgaaatcgccggcacgaagagattccccatatgcagagatcaataac .....
position 3475 (CDS: 312 - 3734)
Synonym: EMARDD
NM_001256545.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant N2BA, mRNA. (104301 bp)
..... aagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaac .....
position 32719 (CDS: 226 - 103278)
NM_001256850.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens POTE ankyrin domain family member D-like (LOC100288966), mRNA. (1826 bp)
..... tgcgtgaaaacagcgtgttgcaggaagaaattgccgtgctaagactggaactaga .....
position 1640 (CDS: 53 - 1807)
NM_001257362.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 1, mRNA. (4142 bp)
..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....
position 1609 (CDS: 118 - 3282)
NM_001257967.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 3, mRNA. (3611 bp)
..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....
position 1634 (CDS: 95 - 3283)
NM_001257968.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 132 (CCDC132), transcript variant 3, mRNA. (5741 bp)
..... atgggtatgaatctgatgaacaagaaaagagtgcctatcaagagtatgacagtga .....
position 1801 (CDS: 247 - 3051)
NM_001257998.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 2, mRNA. (7613 bp)
..... aagacgttcgtaatgccacccaagaagcggttgccgctttgctaaagtgttccct .....
position 5476 (CDS: 223 - 6336)
Synonym: HYC2; MUPP1
NM_001261406.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 3, mRNA. (7526 bp)
..... aagacgttcgtaatgccacccaagaagcggttgccgctttgctaaaggtgagtga .....
position 5476 (CDS: 223 - 6249)
Synonym: HYC2; MUPP1
NM_001261407.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 3, mRNA. (3401 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1166 (CDS: 566 - 2653)
Synonym: MS4A16; NYD-SP21
NM_001261827.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 4, mRNA. (3452 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1217 (CDS: 566 - 2704)
Synonym: MS4A16; NYD-SP21
NM_001261828.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant IC, mRNA. (109224 bp)
..... aagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaac .....
position 33670 (CDS: 226 - 108201)
NM_001267550.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 1, mRNA. (3452 bp)
..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....
position 1764 (CDS: 233 - 3391)
Synonym: Fbw10; HREP; SM25H2; SM2SH2
NM_001267585.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 2, mRNA. (3293 bp)
..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....
position 1764 (CDS: 233 - 3232)
Synonym: Fbw10; HREP; SM25H2; SM2SH2
NM_001267586.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens enkurin, TRPC channel interacting protein (ENKUR), transcript variant 2, mRNA. (3312 bp)
..... agcaacaagtcctacttgctcaagaagagaatgactcaatacgcaggattaggct .....
position 59 (CDS: 320 - 904)
Synonym: C10orf63
NM_001270383.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 2, mRNA. (2525 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....
position 2277 (CDS: 69 - 2327)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271696.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 3, mRNA. (2405 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....
position 2157 (CDS: 69 - 2207)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271697.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 4, mRNA. (2447 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....
position 2199 (CDS: 69 - 2249)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271698.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 5, mRNA. (2408 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....
position 2160 (CDS: 69 - 2210)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271699.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2, mRNA. (6291 bp)
..... gaagacaaagtaccactgataaagaagagattgtcaaatagatgcattcctagtc .....
position 5353 (CDS: 206 - 1120)
Synonym: DUBA8; OTUD2; PRO0907; RP11-164O23.1
NM_001276320.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 2, mRNA. (10440 bp)
..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....
position 475 (CDS: 392 - 5419)
NM_001278469.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 3, mRNA. (10361 bp)
..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....
position 475 (CDS: 392 - 5527)
NM_001278470.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 4, mRNA. (10292 bp)
..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....
position 475 (CDS: 392 - 5458)
NM_001278471.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 5, mRNA. (10457 bp)
..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggtacaga .....
position 475 (CDS: 686 - 5623)
NM_001278472.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 1, mRNA. (3621 bp)
..... aacttgactgatgtaagtgtcaagaaaagattgacattttgttaaaacttcgtag .....
position 3161 (CDS: 414 - 1385)
Synonym: AKR1C-pseudo; BABP; DD; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8
NM_001354.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 2, mRNA. (5066 bp)
..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtacac .....
position 1854 (CDS: 111 - 1823)
Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001387.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens E1A binding protein p300 (EP300), mRNA. (8761 bp)
..... cggcgcggggaccccgggccgaagaagagatttcctgaggattctggttttcctc .....
position 336 (CDS: 396 - 7640)
Synonym: KAT3B; p300; RSTS2
NM_001429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 1, mRNA. (1886 bp)
..... ttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatgga .....
position 601 (CDS: 370 - 1701)
Synonym: ADA2; ADA2A; hADA2; KL04P; TADA2L
NM_001488.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, gamma 1 (ACTG1), transcript variant 2, mRNA. (2004 bp)
..... tttctctgccggtcgcaatggaagaagagatcgccgcgctggtcattgacaatgg .....
position 143 (CDS: 140 - 1267)
Synonym: ACT; ACTG; BRWS2; DFNA20; DFNA26
NM_001614.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 1, mRNA. (3575 bp)
..... aagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaa .....
position 1290 (CDS: 366 - 2486)
Synonym: BCL5; BCL6A; LAZ3; ZBTB27; ZNF51
NM_001706.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens carboxypeptidase A3 (mast cell) (CPA3), mRNA. (1699 bp)
..... aaatcttgattcatgatctacaagaagagattgagaaacagtttgatgttaaaga .....
position 341 (CDS: 53 - 1306)
Synonym: MC-CPA
NM_001870.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 1, mRNA. (2097 bp)
..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....
position 872 (CDS: 211 - 1386)
NM_002139.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inositol 1,4,5-trisphosphate receptor, type 2 (ITPR2), mRNA. (12568 bp)
..... agcaacaaatatcttactgtcaacaagagattacctgctttactggagaagaatg .....
position 819 (CDS: 418 - 8523)
Synonym: IP3R2
NM_002223.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kinesin family member 3C (KIF3C), mRNA. (5431 bp)
..... acacactgctgcgggaattccaagaggagattgcccgcctgaaggcccagctgga .....
position 1807 (CDS: 658 - 3039)
NM_002254.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 2, mRNA. (7355 bp)
..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggc .....
position 4917 (CDS: 399 - 5849)
Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_002290.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens microtubule-associated protein 2 (MAP2), transcript variant 1, mRNA. (9445 bp)
..... ctccagaatcatctctaattcaagatgagattgccgtcaaattgtcagtggaaat .....
position 3732 (CDS: 249 - 5732)
Synonym: MAP2A; MAP2B; MAP2C
NM_002374.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens matrilin 2 (MATN2), transcript variant 1, mRNA. (4122 bp)
..... gaaaagccattgaggaggaactacaagagattgcctctgagcccacaaacaagca .....
position 2635 (CDS: 232 - 3102)
NM_002380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens prefoldin subunit 4 (PFDN4), mRNA. (1383 bp)
..... aagaagcaaagaaaaatttgcaagaagaaattgacgccttagaatccagagtgga .....
position 421 (CDS: 139 - 543)
Synonym: C1; PFD4
NM_002623.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polymerase (DNA directed), alpha 2, accessory subunit (POLA2), mRNA. (2514 bp)
..... actacccactctacccgccccaagaagacatggccattgactatgagtcgttcta .....
position 1885 (CDS: 343 - 2139)
NM_002689.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 1, mRNA. (10127 bp)
..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....
position 6815 (CDS: 744 - 6482)
NM_002839.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 1, mRNA. (3722 bp)
..... gcccctgatgcttcggggccccagaagagatcgccaggagacactgccaaagatg .....
position 177 (CDS: 28 - 927)
Synonym: D1S2223E; HK33; PBD12A; PMP1; PMPI; PXF; PXMP1
NM_002857.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens UPF1 regulator of nonsense transcripts homolog (yeast) (UPF1), mRNA. (5360 bp)
..... tcttctacgtgacccagggccaagaggagattgccagctcgggcacctcctacct .....
position 2535 (CDS: 276 - 3632)
Synonym: HUPF1; NORF1; pNORF1; RENT1; smg-2
NM_002911.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens spectrin, alpha, erythrocytic 1 (elliptocytosis 2) (SPTA1), mRNA. (8017 bp)
..... ttgctgatgaacactatgccaaagaagagattgctacgcggctccaacgtgtact .....
position 4601 (CDS: 200 - 7459)
Synonym: EL2; HPP; HS3; SPH3; SPTA
NM_003126.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens translocated promoter region, nuclear basket protein (TPR), mRNA. (9727 bp)
..... gtaaaggagccatattgtctgaagaagagcttgccgccatgtctcctactgcagc ..... aagaactattaaaaaatgctcaaaaagaaattgccacattgaaacagcacctcag .....
position 1411 2989 (CDS: 298 - 7389)
NM_003292.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vimentin (VIM), mRNA. (2151 bp)
..... aacgcaaagtggaatctttgcaagaagagattgcctttttgaagaaactccacga .....
position 1095 (CDS: 414 - 1814)
NM_003380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens poly (ADP-ribose) glycohydrolase (PARG), mRNA. (4276 bp)
..... atcattccatcacaatgtcgcaggaacagattgccagtcttttagctaatgcttt .....
position 2140 (CDS: 262 - 3192)
Synonym: PARG99
NM_003631.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 3, mRNA. (6041 bp)
..... agagtggacactgctgttatcaagcagagagtgccgatcttactcaagtacctag .....
position 4723 (CDS: 257 - 5014)
Synonym: eIF-4G 3; eIF4G 3; eIF4GII
NM_003760.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin, heavy chain 13, skeletal muscle (MYH13), mRNA. (5992 bp)
..... ggcgagagaacaaaaatctgcaagaagagatttccgacttaactgagcagattgc .....
position 4618 (CDS: 91 - 5907)
Synonym: MyHC-eo
NM_003802.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 (CDS2), mRNA. (9323 bp)
..... ggtaagggccctctggaaatcaagcagagaatgcctttgcagtggtctcccgggc .....
position 7839 (CDS: 333 - 1670)
NM_003818.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 1, mRNA. (7625 bp)
..... aagacgttcgtaatgccacccaagaagcggttgccgctttgctaaaggtgagtga .....
position 5575 (CDS: 223 - 6348)
Synonym: HYC2; MUPP1
NM_003829.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 (ATP6V0E1), mRNA. (894 bp)
..... gtgctcagtctttgaggtcacgagaagagaatgccttctagatgcaaaatcacct .....
position 388 (CDS: 102 - 347)
Synonym: ATP6H; ATP6V0E; M9.2; Vma21; Vma21p
NM_003945.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens heat shock 70kDa protein 9 (mortalin) (HSPA9), mRNA. (3506 bp)
..... ctgatgagtgcaacaagctgaaagaagagatttccaaaatgagggagctcctggc .....
position 2145 (CDS: 312 - 2351)
Synonym: CSA; GRP-75; GRP75; HSPA9B; MOT; MOT2; MTHSP75; PBP74
NM_004134.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 1, mRNA. (2528 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....
position 2280 (CDS: 69 - 2330)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_004299.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome c oxidase assembly homolog 15 (yeast) (COX15), transcript variant 2, mRNA. (6450 bp)
..... ggctgggcttatgctattgcctagaagagattcccaacttctctcttatttgaat .....
position 3466 (CDS: 618 - 1784)
Synonym: CEMCOX2
NM_004376.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant A, mRNA. (9752 bp)
..... cgttcaggtgcttggaccttcaggaaaagattgcccatcttgtcatttgaccagg .....
position 8339 (CDS: 252 - 1235)
Synonym: CREB
NM_004379.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 1, mRNA. (4005 bp)
..... tgatgccacgcttcgctgaacaagtagaggttgccattgaagccctgagtgccaa .....
position 2041 (CDS: 280 - 2997)
Synonym: CAP-R; CAPR; CT114; CTNR
NM_004389.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA. (3883 bp)
..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgcag .....
position 1109 (CDS: 216 - 2624)
Synonym: MSK1; MSPK1; RLPK
NM_004755.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kinesin family member 3B (KIF3B), mRNA. (6135 bp)
..... atgccctccttcgagaattccaggaagagattgctcggctcaaggcccagctgga .....
position 1255 (CDS: 181 - 2424)
Synonym: FLA8; HH0048; KLP-11
NM_004798.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leupaxin (LPXN), transcript variant 2, mRNA. (1926 bp)
..... attttgtctgtactcattgcaaagaagagattggctccagtcccttctttgagcg .....
position 689 (CDS: 146 - 1306)
Synonym: LDPL
NM_004811.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldolase C, fructose-bisphosphate (ALDOC), mRNA. (1665 bp)
..... cctgtcccatcaagtataccccagaggagattgccatggcaactgtcactgccct .....
position 881 (CDS: 146 - 1240)
Synonym: ALDC
NM_005165.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LIM domain 7 (LMO7), transcript variant 1, mRNA. (7253 bp)
..... caaatcgagtcactgtcaagcaagaagagactgacaggagagtgaaaaatgtttt .....
position 1735 (CDS: 1261 - 5310)
Synonym: FBX20; FBXO20; LOMP
NM_005358.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, non-receptor type 14 (PTPN14), mRNA. (13443 bp)
..... ttctagtggagctcatcaacaaagaagagactgccctctttcacacggatgatat .....
position 1473 (CDS: 654 - 4217)
Synonym: PEZ; PTP36
NM_005401.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens inositol(myo)-1(or 4)-monophosphatase 1 (IMPA1), transcript variant 1, mRNA. (3396 bp)
..... aaaaactacaagtttcacaacaagaagatattaccaaatctctcttggtgactga .....
position 578 (CDS: 128 - 961)
Synonym: IMP; IMPA
NM_005536.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lipoprotein, Lp(a) (LPA), mRNA. (6489 bp)
..... ggctgttcttggagcccacacaagcagatattgccttgctaaagctaagcaggcc .....
position 5824 (CDS: 121 - 6243)
Synonym: AK38; APOA; LP
NM_005577.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 239 (ZNF239), transcript variant 1, mRNA. (2406 bp)
..... atgacaactcagcaatgacacaagaagagagtgacacagaaagattcagtagctg .....
position 169 (CDS: 654 - 2030)
Synonym: HOK-2; MOK2
NM_005674.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I, mRNA. (3007 bp)
..... tccacccccacagcagacctcaagtagaaattgcccaatttttaccagctggagg .....
position 2682 (CDS: 127 - 1494)
Synonym: EAD
NM_005677.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phenylalanyl-tRNA synthetase, beta subunit (FARSB), mRNA. (2233 bp)
..... ttacctttgccctgtgctcccaagaagatattgctgataaactaggtgtggatat .....
position 1293 (CDS: 36 - 1805)
Synonym: FARSLB; FRSB; HSPC173; PheHB; PheRS
NM_005687.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 1, mRNA. (3506 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....
position 1137 (CDS: 183 - 2552)
Synonym: CALCOCO3; T6BP; TXBP151
NM_006024.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta (PIK3CB), transcript variant 1, mRNA. (5931 bp)
..... agatcaagaaaatgtatgaacaagaaatgattgccatagaggctgccataaatcg .....
position 899 (CDS: 17 - 3229)
Synonym: P110BETA; PI3K; PI3KBETA; PIK3C1
NM_006219.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein phosphatase 2, regulatory subunit B', beta (PPP2R5B), mRNA. (2766 bp)
..... ggggagggggagggcacaggcaagaagagattcacagtgtcctggggtaaggggg .....
position 2643 (CDS: 623 - 2116)
Synonym: B56B; PR61B
NM_006244.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens intersectin 2 (ITSN2), transcript variant 1, mRNA. (6112 bp)
..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaagaa .....
position 1690 (CDS: 259 - 5352)
Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_006277.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CMT1A duplicated region transcript 1 (CDRT1), mRNA. (2780 bp)
..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....
position 1724 (CDS: 193 - 2451)
Synonym: C170RF1; C17ORF1; C17ORF1A; FBXW10B; FBXW10P1; HREP; SM25H2
NM_006382.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fucosyltransferase 9 (alpha (1,3) fucosyltransferase) (FUT9), mRNA. (12815 bp)
..... ctgaagatgccatccttgtccaaggtgagattgccagaggatatgagctcatcta .....
position 9453 (CDS: 342 - 1421)
Synonym: Fuc-TIX
NM_006581.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 1, mRNA. (7163 bp)
..... acagtcacccatgttagccacaagaagaggttggctgtttatggtttgcacagtg .....
position 5977 (CDS: 208 - 2262)
Synonym: EF-1a; ERFS; HBS1; HSPC276
NM_006620.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2), mRNA. (9732 bp)
..... cgccctctgagcaggttcttcaagaagattttgcctcggcaaatgctgggtcttt .....
position 4686 (CDS: 744 - 8084)
Synonym: HIV-EP2; MBP-2; MIBP1; SHN2; ZAS2; ZNF40B
NM_006734.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin IXA (MYO9A), mRNA. (8722 bp)
..... aacttcataagactatgtctcaaggagagattaccaagttggcagtgagacagaa .....
position 5691 (CDS: 492 - 8138)
NM_006901.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 1, mRNA. (3602 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....
position 3091 (CDS: 112 - 1683)
Synonym: BT2.2; BTF2
NM_006995.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 1, mRNA. (3520 bp)
..... ctaggtcggcgcccgatcggcaagaagagattagcaaattgatgcgaagtgcaag .....
position 1167 (CDS: 42 - 2621)
Synonym: EIF2C2; Q10
NM_012154.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATPase, H+ transporting, lysosomal V0 subunit a2 (ATP6V0A2), mRNA. (6550 bp)
..... tataaatgaagatattttaccatgaagagattgcacttatccttgagaacagtct ..... tataaatgaagatattttaccatgaagagattgcacttatccttgagaacagtct .....
position 3995 4053 (CDS: 249 - 2819)
Synonym: A2; ARCL; ARCL2A; ATP6A2; ATP6N1D; J6B7; RTF; STV1; TJ6; TJ6M; TJ6S; VPH1; WSS
NM_012463.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitochondrial ribosomal protein S18B (MRPS18B), mRNA. (1536 bp)
..... ggctttaccagggtcatctccaagaagagagtggccccccacctgagtcaatgcc .....
position 830 (CDS: 158 - 934)
Synonym: C6orf14; HSPC183; HumanS18a; MRP-S18-2; MRPS18-2; PTD017; S18amt
NM_014046.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens trichorhinophalangeal syndrome I (TRPS1), mRNA. (9990 bp)
..... gtgattttattacccaagtggaagaagagatttcccgacactacaggagagcaca .....
position 2649 (CDS: 579 - 4463)
Synonym: GC79; LGCR
NM_014112.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger and BTB domain containing 44 (ZBTB44), mRNA. (9351 bp)
..... actggtgcctcccgttgcatcaggtagagattgcctgcctctttgtagggcagcc .....
position 7877 (CDS: 395 - 1756)
Synonym: BTBD15; HSPC063; ZNF851
NM_014155.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 5, mRNA. (4161 bp)
..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....
position 139 (CDS: 307 - 1746)
Synonym: 39K2; 39K3
NM_014393.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lipin 2 (LPIN2), mRNA. (6245 bp)
..... atccttagcttgcaagtattccagaagagcttgcctaaggccacagttgagtcct .....
position 1841 (CDS: 240 - 2930)
NM_014646.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 2, mRNA. (6420 bp)
..... tccaaccttggcccctctgacaagaagagcttcccaatcatctctggaaagttca .....
position 3751 (CDS: 321 - 3812)
Synonym: OBOE; RAB3IP3; RIM2
NM_014677.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 144A (CCDC144A), mRNA. (5828 bp)
..... ttcatgaagattgcatgttgcaggaagaaattgccttgctgagactggaaataga .....
position 2549 (CDS: 77 - 4360)
NM_014695.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens STE20-like kinase (SLK), mRNA. (5629 bp)
..... gacctaggaaaaagacactggaagaagagtttgccaggaaactacaggaacagga .....
position 3602 (CDS: 35 - 3742)
Synonym: bA16H23.1; LOSK; se20-9; STK2
NM_014720.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA. (2807 bp)
..... accagggggagagaccagaccaagaagagaatggccaagcccaaaaaccgggctg .....
position 590 (CDS: 489 - 2387)
Synonym: ALEX2
NM_014782.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 350kDa (CEP350), mRNA. (13473 bp)
..... gttctgaattggaagatgaaaaagaagagatttcctctccagatatgtgtcccag .....
position 8856 (CDS: 384 - 9737)
Synonym: CAP350; GM133
NM_014810.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant alpha, mRNA. (7204 bp)
..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....
position 4303 (CDS: 409 - 5163)
Synonym: FAM68A; KAB; KIAA0470
NM_014812.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 1, mRNA. (4901 bp)
..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....
position 1597 (CDS: 292 - 3345)
Synonym: KIAA1018; KMIN; MTMR15
NM_014967.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin, heavy chain 15 (MYH15), mRNA. (7074 bp)
..... ggagggagaacaagaacctccaagaagagatttctaatctgacaaaccaggttag .....
position 4609 (CDS: 58 - 5898)
NM_014981.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 1, mRNA. (10379 bp)
..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....
position 475 (CDS: 392 - 5545)
NM_015026.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens trafficking protein, kinesin binding 2 (TRAK2), mRNA. (6527 bp)
..... gtgatgagctgattcgataccaagaagagctttcctctcttttgtcacagattgt .....
position 1287 (CDS: 447 - 3191)
Synonym: ALS2CR3; CALS-C; GRIF-1; GRIF1; MILT2; OIP98
NM_015049.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MYC binding protein 2, E3 ubiquitin protein ligase (MYCBP2), mRNA. (15025 bp)
..... cttgatccagataccctccgcaagaagaaaatgcccctcacagaacctttgagag .....
position 8913 (CDS: 268 - 14304)
Synonym: PAM
NM_015057.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant 1, mRNA. (10960 bp)
..... tcaacattaacttttcctgaaaagaagagtttgcctaacatggtcctaaagaagc .....
position 7401 (CDS: 90 - 3206)
Synonym: M-RIP; MRIP; p116Rip; RHOIP3; RIP3
NM_015134.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 1, mRNA. (5705 bp)
..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....
position 5340 (CDS: 359 - 3865)
Synonym: TBC; TBC1
NM_015173.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ubiquitin protein ligase E3 component n-recognin 2 (UBR2), transcript variant 1, mRNA. (7898 bp)
..... acaaagctgagaggaagagaaaagcagagattgccagactgcgcagagaaaagat .....
position 3398 (CDS: 299 - 5566)
Synonym: bA49A4.1; C6orf133; dJ242G1.1; dJ392M17.3; RP3-392M17.3
NM_015255.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HAUS augmin-like complex, subunit 5 (HAUS5), mRNA. (4309 bp)
..... tgggggtgaggaatgtattaaaagatgagattgccttctagtttgtatagtttct .....
position 2551 (CDS: 52 - 1953)
Synonym: dgt5; KIAA0841
NM_015302.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens UFM1-specific ligase 1 (UFL1), mRNA. (4219 bp)
..... ataatgaattagacaaagaacaagaagatgttgccagtactactcgtaaagagct .....
position 2329 (CDS: 49 - 2433)
Synonym: KIAA0776; Maxer; NLBP; RCAD; RP3-393D12.1
NM_015323.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ABI family, member 3 (NESH) binding protein (ABI3BP), mRNA. (4488 bp)
..... ctgagcacaaaaagataatgcacgatgagattgcctaccattttataggatattt .....
position 4149 (CDS: 86 - 3313)
NM_015429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 2, mRNA. (3487 bp)
..... tggtcctaggctcacctaagccagaagagattccccttacttggatacaaccagg .....
position 964 (CDS: 145 - 3081)
Synonym: dJ292B18.2; FTHFSDC1; MTC1THFS; RP1-292B18.2
NM_015440.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5), mRNA. (4582 bp)
..... cttaaagggcttgggaataacaagaagagattgaagacagagaagcttgccctgt .....
position 451 (CDS: 1257 - 3404)
Synonym: DHHC5; ZNF375
NM_015457.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LIM domain 7 (LMO7), transcript variant 2, mRNA. (6791 bp)
..... caaatcgagtcactgtcaagcaagaagagactgacaggagagtgaaaaatgtttt .....
position 380 (CDS: 761 - 4918)
Synonym: FBX20; FBXO20; LOMP
NM_015842.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1, mRNA. (6382 bp)
..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....
position 943 (CDS: 331 - 1428)
Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_016009.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SHC (Src homology 2 domain containing) transforming protein 3 (SHC3), mRNA. (9768 bp)
..... cctggtgcgaagggagccttcaagaagagaaagcctccaagcaaaatgctgtcca .....
position 904 (CDS: 308 - 2092)
Synonym: N-Shc; NSHC; RAI; SHCC
NM_016848.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 1, mRNA. (8979 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....
position 913 (CDS: 205 - 2619)
Synonym: HSSOX6; SOXD
NM_017508.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 132 (CCDC132), transcript variant 1, mRNA. (5713 bp)
..... atgggtatgaatctgatgaacaagaaaagagtgcctatcaagagtatgacagtga .....
position 1773 (CDS: 129 - 3023)
NM_017667.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens INO80 complex subunit D (INO80D), mRNA. (14136 bp)
..... gtttgtaatttccctttaaacaagaagagatggctcacattttccatatatatct .....
position 13847 (CDS: 406 - 3489)
NM_017759.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript variant 1, mRNA. (4311 bp)
..... ccactcgagcccagcaactggaagaagacattgccctgtttgaggctcagtactt .....
position 1391 (CDS: 32 - 3460)
Synonym: CILD15
NM_017950.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA. (6873 bp)
..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaattaa .....
position 2973 (CDS: 105 - 4355)
Synonym: NUCLING
NM_018003.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 1, mRNA. (6265 bp)
..... gaagacaaagtaccactgataaagaagagattgtcaaatagatgcattcctagtc .....
position 5327 (CDS: 48 - 1094)
Synonym: DUBA8; OTUD2; PRO0907; RP11-164O23.1
NM_018566.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin beta 14 (PCDHB14), mRNA. (3973 bp)
..... acggctgagcttcagtttttccacaagagattgcctaaaggaaccatggagatca .....
position 1156 (CDS: 1181 - 3577)
Synonym: PCDH-BETA14
NM_018934.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens KIAA1217 (KIAA1217), transcript variant 1, mRNA. (7773 bp)
..... gcagagagaacttgtttatgcaagaggagatggccctggggcccctcgccccgga .....
position 1272 (CDS: 404 - 6235)
Synonym: RP11-324E23.1; SKT
NM_019590.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens intersectin 2 (ITSN2), transcript variant 3, mRNA. (6031 bp)
..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaagaa .....
position 1690 (CDS: 259 - 5271)
Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_019595.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RNA binding motif protein, X-linked-like 1 (RBMXL1), transcript variant 2, mRNA. (5028 bp)
..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatacaaga .....
position 1278 (CDS: 617 - 1789)
Synonym: RBM1
NM_019610.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Ral GTPase activating protein, beta subunit (non-catalytic) (RALGAPB), mRNA. (8636 bp)
..... atgatggtgaaggatctcaacaagaagtgatttcctctgaagatattggagctag .....
position 3951 (CDS: 258 - 4742)
Synonym: dJ1100H13.1; KIAA1219; RalGAPbeta; RP5-1100H13.1
NM_020336.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane protein 181 (TMEM181), mRNA. (5397 bp)
..... ttatattcagatttttcttacaagcagagatttcctgttcatttgtttacatatt .....
position 1944 (CDS: 12 - 1850)
Synonym: GPR178; KIAA1423
NM_020823.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ZFP14 zinc finger protein (ZFP14), mRNA. (7502 bp)
..... gatggttgtgagggaagggacaagaagatactgccctgatttggagtccagatac .....
position 338 (CDS: 121 - 1722)
Synonym: ZNF531
NM_020917.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 1, mRNA. (6573 bp)
..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....
position 541 (CDS: 197 - 3271)
NM_021115.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centromere protein H (CENPH), mRNA. (1405 bp)
..... gaaaaactgcttgatattagaaagaagagattgcaattaaaacaagcttcagaaa .....
position 561 (CDS: 88 - 831)
NM_022909.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens derlin 1 (DERL1), transcript variant 1, mRNA. (3344 bp)
..... cccaacccccacatttgcaactagaagaggttgcccataaaattgctctgccctt .....
position 1475 (CDS: 302 - 1057)
Synonym: DER-1; DER1
NM_024295.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 1, mRNA. (3685 bp)
..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgcaag .....
position 1472 (CDS: 170 - 3532)
Synonym: FAM42A; HsT19294; RIA1
NM_024580.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 1, mRNA. (4298 bp)
..... tctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttaca .....
position 1435 (CDS: 300 - 2228)
Synonym: C10orf119; MCM-BP
NM_024834.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens L-2-hydroxyglutarate dehydrogenase (L2HGDH), mRNA. (6111 bp)
..... agcttatagtagctgttgaacaagaagaaattcccagacttcaggccctatatga .....
position 506 (CDS: 80 - 1471)
Synonym: C14orf160
NM_024884.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA. (7555 bp)
..... tcacagcctctgattttttccaagaagagattgccttcaccattgttaaatgtca .....
position 5996 (CDS: 138 - 5750)
NM_024940.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens valosin containing protein (p97)/p47 complex interacting protein 1 (VCPIP1), mRNA. (8176 bp)
..... actcagcccacactgtgaaacaagaagatattgctgttactggtaaactgtcatc .....
position 2870 (CDS: 260 - 3928)
Synonym: DUBA3; VCIP135
NM_025054.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ankyrin repeat domain 36B (ANKRD36B), mRNA. (5986 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....
position 3137 (CDS: 281 - 4342)
Synonym: KIAA1641
NM_025190.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens matrilin 2 (MATN2), transcript variant 2, mRNA. (4065 bp)
..... gaaaagccattgaggaggaactacaagagattgcctctgagcccacaaacaagca .....
position 2635 (CDS: 232 - 3045)
NM_030583.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens bromodomain adjacent to zinc finger domain, 1B (BAZ1B), mRNA. (6133 bp)
..... cagctgctgagaaagctttccaggaagggattgccaaggccaaactagtcatgcg .....
position 3014 (CDS: 353 - 4804)
Synonym: WBSCR10; WBSCR9; WSTF
NM_032408.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens multiple EGF-like-domains 10 (MEGF10), transcript variant 1, mRNA. (7689 bp)
..... tgtggagatgaaatcgccggcacgaagagattccccatatgcagagatcaataac .....
position 3526 (CDS: 363 - 3785)
Synonym: EMARDD
NM_032446.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 1, mRNA. (3353 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1118 (CDS: 566 - 2605)
Synonym: MS4A16; NYD-SP21
NM_032597.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger and SCAN domain containing 10 (ZSCAN10), mRNA. (2463 bp)
..... caggtccccagccacagccccaagaaggaattgcctgcggaagagccttcagtgc .....
position 412 (CDS: 89 - 2266)
Synonym: ZNF206
NM_032805.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 2, mRNA. (2718 bp)
..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....
position 1250 (CDS: 113 - 1765)
Synonym: AIRP; CN-IB; CN1B
NM_033253.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 2, mRNA. (8865 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....
position 778 (CDS: 79 - 2505)
Synonym: HSSOX6; SOXD
NM_033326.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 2, mRNA. (2751 bp)
..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....
position 819 (CDS: 71 - 1066)
Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_052931.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin light chain kinase (MYLK), transcript variant 1, mRNA. (7852 bp)
..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....
position 3243 (CDS: 283 - 6027)
Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053025.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin light chain kinase (MYLK), transcript variant 2, mRNA. (7645 bp)
..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....
position 3036 (CDS: 283 - 5820)
Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053026.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin light chain kinase (MYLK), transcript variant 3A, mRNA. (7699 bp)
..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....
position 3243 (CDS: 283 - 5874)
Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053027.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin light chain kinase (MYLK), transcript variant 3B, mRNA. (7492 bp)
..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....
position 3036 (CDS: 283 - 5667)
Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053028.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome c oxidase assembly homolog 15 (yeast) (COX15), transcript variant 1, mRNA. (7689 bp)
..... ggctgggcttatgctattgcctagaagagattcccaacttctctcttatttgaat .....
position 4705 (CDS: 618 - 1850)
Synonym: CEMCOX2
NM_078470.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant II, mRNA. (3136 bp)
..... tccacccccacagcagacctcaagtagaaattgcccaatttttaccagctggagg .....
position 2811 (CDS: 286 - 1623)
Synonym: EAD
NM_080538.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant III, mRNA. (2905 bp)
..... tccacccccacagcagacctcaagtagaaattgcccaatttttaccagctggagg .....
position 2580 (CDS: 127 - 1392)
Synonym: EAD
NM_080539.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 2, mRNA. (8266 bp)
..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....
position 4954 (CDS: 104 - 4621)
NM_130391.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 3, mRNA. (8269 bp)
..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....
position 4957 (CDS: 104 - 4624)
NM_130392.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA. (8239 bp)
..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....
position 4927 (CDS: 104 - 4594)
NM_130393.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens progestin and adipoQ receptor family member VIII (PAQR8), mRNA. (4758 bp)
..... atgatgagcacaggaacaggcatgaagatattgccatacaattttaatttataca .....
position 3457 (CDS: 175 - 1239)
Synonym: C6orf33; LMPB1; MPRB
NM_133367.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant N2-A, mRNA. (101520 bp)
..... aagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaac .....
position 29938 (CDS: 226 - 100497)
NM_133378.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 2, mRNA. (1327 bp)
..... ttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatgga .....
position 601 (CDS: 370 - 1287)
Synonym: ADA2; ADA2A; hADA2; KL04P; TADA2L
NM_133439.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant B, mRNA. (9794 bp)
..... cgttcaggtgcttggaccttcaggaaaagattgcccatcttgtcatttgaccagg .....
position 8381 (CDS: 252 - 1277)
Synonym: CREB
NM_134442.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, ionotropic, N-methyl-D-aspartate 3B (GRIN3B), mRNA. (3270 bp)
..... agcagcgccgaggcgtacatcaagaagagcttccccgacatgcacgcacacatgc .....
position 2118 (CDS: 1 - 3132)
Synonym: GluN3B; NR3B
NM_138690.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polycystic kidney and hepatic disease 1 (autosomal recessive) (PKHD1), transcript variant 1, mRNA. (16235 bp)
..... gcaggaatgtggagagcttccaaaaagagattgctctcagattttcctgaaaatc .....
position 13652 (CDS: 277 - 12501)
NM_138694.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 1, mRNA. (8691 bp)
..... cctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatgga .....
position 536 (CDS: 272 - 1846)
NM_138959.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 480 (ZNF480), mRNA. (4742 bp)
..... ataaccccccaagattgaaccaagaagaaattgcatccctgaacagaccaataat .....
position 2072 (CDS: 71 - 1678)
NM_144684.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens EF-hand domain family, member B (EFHB), mRNA. (2857 bp)
..... acttcttcaagaccagatcaaaagaagagattgcagagatattgtgtaacattgg .....
position 2516 (CDS: 197 - 2698)
NM_144715.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger, C3H1-type containing (ZFC3H1), mRNA. (7158 bp)
..... agattgaatatagattgttaaaggaagagattgccaaccgtgagaaacagcgttt .....
position 2703 (CDS: 360 - 6329)
Synonym: CCDC131; PSRC2
NM_144982.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine rich repeat containing 45 (LRRC45), mRNA. (2639 bp)
..... tggagactattgataagcagcgagaagagatggccaagagcagcagggcgtcggc .....
position 1048 (CDS: 241 - 2253)
NM_144999.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fucokinase (FUK), mRNA. (3923 bp)
..... tgaccagagcaagatctgggcaagcagagagtgcctgggacaggactgtgacctg .....
position 3457 (CDS: 59 - 3313)
Synonym: 1110046B12Rik
NM_145059.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 2, mRNA. (1569 bp)
..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....
position 424 (CDS: 223 - 861)
Synonym: DEN1; NEDP1; PRSC2
NM_145204.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens stomatin (EPB72)-like 3 (STOML3), transcript variant 1, mRNA. (1936 bp)
..... tgtcccagatcttagctggacgagaagagatcgcccatagcatccagactttact .....
position 628 (CDS: 139 - 1014)
Synonym: Epb7.2l; SRO
NM_145286.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens intersectin 2 (ITSN2), transcript variant 2, mRNA. (4597 bp)
..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaagaa .....
position 1690 (CDS: 259 - 4008)
Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_147152.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine rich repeat and fibronectin type III domain containing 5 (LRFN5), mRNA. (3747 bp)
..... tgtccaaacaagctgtgggacacgaagagaatgcccagtgttgtaaagctaccag .....
position 2984 (CDS: 1199 - 3358)
Synonym: C14orf146; FIGLER8; SALM5
NM_152447.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens pseudouridylate synthase-like 1 (PUSL1), mRNA. (1262 bp)
..... caggacacagccatgtacaccaagaagagagtaccaagtagtcttttgttcagct .....
position 1142 (CDS: 31 - 942)
NM_153339.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lysophosphatidylcholine acyltransferase 4 (LPCAT4), mRNA. (1908 bp)
..... gccggagtcgaatgatcagccaggaagagtttgccaggcagctacagctctctga .....
position 1163 (CDS: 95 - 1669)
Synonym: AGPAT7; AYTL3; LPAAT-eta; LPEAT2
NM_153613.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 1, mRNA. (9757 bp)
..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgctt .....
position 2966 (CDS: 24 - 1892)
Synonym: NCKX4; SHEP6; SLC24A2
NM_153646.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 2, mRNA. (9773 bp)
..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgctt .....
position 2982 (CDS: 97 - 1908)
Synonym: NCKX4; SHEP6; SLC24A2
NM_153647.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 3, mRNA. (9659 bp)
..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgctt .....
position 2868 (CDS: 118 - 1794)
Synonym: NCKX4; SHEP6; SLC24A2
NM_153648.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens l(3)mbt-like 4 (Drosophila) (L3MBTL4), mRNA. (3604 bp)
..... ggcattcccaggaactccctgaagaagatattgcctcaggccaagaagtcagggg .....
position 2035 (CDS: 202 - 2073)
Synonym: HsT1031
NM_173464.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens POTE ankyrin domain family, member D (POTED), mRNA. (1826 bp)
..... tgcgtgaaaacagcgtgttgcaggaagaaattgccatgctaagactggaactaga .....
position 1640 (CDS: 53 - 1807)
Synonym: A26B3; ANKRD21; CT104.1; POTE; POTE-21; POTE21
NM_174981.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA. (2858 bp)
..... accagggggagagaccagaccaagaagagaatggccaagcccaaaaaccgggctg .....
position 641 (CDS: 540 - 2438)
Synonym: ALEX2
NM_177949.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1, mRNA. (6998 bp)
..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttga .....
position 704 (CDS: 155 - 5209)
Synonym: GCC185; RANBP2L4; REN53
NM_181453.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 445 (ZNF445), mRNA. (10264 bp)
..... tatttaagtagctaaaaaggcaagaagaaaatgccaaggtgtcttggaggtagca .....
position 9884 (CDS: 349 - 3444)
Synonym: ZKSCAN15; ZNF168; ZSCAN47
NM_181489.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 2, mRNA. (3251 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....
position 2743 (CDS: 112 - 1335)
Synonym: BT2.2; BTF2
NM_181531.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 2, mRNA. (2343 bp)
..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgcag .....
position 1109 (CDS: 216 - 1865)
Synonym: MSK1; MSPK1; RLPK
NM_182398.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitochondrial ribosomal protein S9 (MRPS9), mRNA. (1473 bp)
..... aagatccagaaactttcactcaagaagatattgacagagctattgcttacctttt .....
position 369 (CDS: 69 - 1259)
Synonym: MRP-S9; RPMS9; S9mt
NM_182640.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 2, mRNA. (1597 bp)
..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....
position 1012 (CDS: 277 - 1371)
Synonym: ALDA; GSD12
NM_184041.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 3, mRNA. (1569 bp)
..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....
position 984 (CDS: 249 - 1343)
Synonym: ALDA; GSD12
NM_184043.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 1, mRNA. (7471 bp)
..... cttgtttccaccaatagtgccaaaaagatattgcctaatgtgcacctgtgaggtg .....
position 2258 (CDS: 397 - 1959)
Synonym: BBF2H7
NM_194071.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 2, mRNA. (4030 bp)
..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....
position 1497 (CDS: 36 - 3170)
NM_194300.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 1, mRNA. (3395 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....
position 1706 (CDS: 135 - 1892)
Synonym: FAM13C1
NM_198215.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polymerase (DNA directed), theta (POLQ), mRNA. (8787 bp)
..... tgtggcttgccctgatcggccgagaagagtttgccatgaatcttctgcgtcggag .....
position 115 (CDS: 130 - 7902)
Synonym: POLH; PRO0327
NM_199420.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant 2, mRNA. (11023 bp)
..... tcaacattaacttttcctgaaaagaagagtttgcctaacatggtcctaaagaagc .....
position 7464 (CDS: 90 - 3167)
Synonym: M-RIP; MRIP; p116Rip; RHOIP3; RIP3
NM_201274.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glycerol kinase (GK), transcript variant 1, mRNA. (4503 bp)
..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....
position 3217 (CDS: 180 - 1772)
Synonym: GK1; GKD
NM_203391.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 2, mRNA. (3521 bp)
..... aacttgactgatgtaagtgtcaagaaaagattgacattttgttaaaacttcgtag .....
position 3061 (CDS: 314 - 1285)
Synonym: AKR1C-pseudo; BABP; DD; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8
NM_205845.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CPS1 intronic transcript 1 (non-protein coding) (CPS1-IT1), non-coding RNA. (2306 bp)
..... tagcggtattagataaataacaagaatagatggccactaaagctacctgtctcca .....
position 1039
Synonym: CPS1-IT; CPS1IT; CPS1IT1; PRO0132
NR_002763.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 170kDa pseudogene 1 (CEP170P1), non-coding RNA. (1091 bp)
..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....
position 157
Synonym: CEP170L; FAM68B; KIAA0470L
NR_003135.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 144C, pseudogene (CCDC144CP), non-coding RNA. (4204 bp)
..... ttcatgaaaattgcatgttgcaggaagaaattgccttgctgagactggaaataga .....
position 2620
Synonym: CCDC144C
NR_023380.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens long intergenic non-protein coding RNA 51 (LINC00051), non-coding RNA. (1058 bp)
..... ataggaggcctgaagaaccacatgaagagagtgcccacaacccagaggatctcct .....
position 476
Synonym: C8orf43; NCRNA00051
NR_024378.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, gamma 1 pseudogene 4 (ACTG1P4), non-coding RNA. (1988 bp)
..... ctcctccaccagtcgcaatggaagaagagattgccgtactggtgattgacaatgg .....
position 153
Synonym: ACTGP4
NR_024438.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MRPL23 antisense RNA 1 (MRPL23-AS1), non-coding RNA. (1904 bp)
..... gcggaggctgttttttgctccaagaggacattgcctcagcagagggctgccgagc .....
position 1257
NR_024471.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chromosome 14 open reading frame 23 (C14orf23), transcript variant 1, non-coding RNA. (3154 bp)
..... gaaatttgaaataaagaacacaaaatgagattgccctttggttgttaaaattgca .....
position 1575
Synonym: c14_5148
NR_026731.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ankyrin repeat domain 36B pseudogene 1 (ANKRD36BP1), non-coding RNA. (1879 bp)
..... tgcataaaaaccatttgatgcaagatgaaattgccaggctcaggctggaaataca .....
position 467
Synonym: ANKRD26L1; ANKRD36BL1
NR_026844.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens POTE ankyrin domain family, member F pseudogene (LOC100130331), non-coding RNA. (3148 bp)
..... ctcctccaccagtcacgatggaagaagagatcgccacgcttgccattgacaatgg .....
position 1640
NR_027247.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 3, non-coding RNA. (3643 bp)
..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatttt .....
position 1272
Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NR_028041.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 2, non-coding RNA. (6913 bp)
..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttga .....
position 619
Synonym: GCC185; RANBP2L4; REN53
NR_028063.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 3, non-coding RNA. (1925 bp)
..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....
position 700
NR_028476.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 4, non-coding RNA. (2132 bp)
..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....
position 907
NR_028477.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens poly (ADP-ribose) glycohydrolase pseudogene (LOC728407), non-coding RNA. (1420 bp)
..... atcattccatcacaatgtcgcaggaacagattgccagtcttttagctaatgcttt .....
position 756
NR_029388.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ankyrin repeat domain 26 pseudogene (LOC650226), non-coding RNA. (1667 bp)
..... tgcataaaaatagtatgttgcaggaagaaattgccatgctaagactggaactaga .....
position 788
NR_029420.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 3, non-coding RNA. (3608 bp)
..... gcccctgatgcttcggggccccagaagagatcgccaggagacactgccaaagatg .....
position 177
Synonym: D1S2223E; HK33; PBD12A; PMP1; PMPI; PXF; PXMP1
NR_036493.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 144B (pseudogene) (CCDC144B), non-coding RNA. (8713 bp)
..... ttcatgaaaattgcatgttgcaggaagaaattgccttgctgagactggaaataga .....
position 2642
NR_036647.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens elongation factor Tu GTP binding domain containing 1 pseudogene 1 (EFTUD1P1), non-coding RNA. (1167 bp)
..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgcaag .....
position 719
Synonym: FAM42B; HsT19321
NR_036652.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, gamma 1 (ACTG1), transcript variant 3, non-coding RNA. (1855 bp)
..... tttctctgccggtcgcaatggaagaagagatcgccgcgctggtcattgacaatgg .....
position 143
Synonym: ACT; ACTG; BRWS2; DFNA20; DFNA26
NR_037688.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC100506025 (LOC100506025), transcript variant 1, non-coding RNA. (2264 bp)
..... agttctggaagttggaagtacaagatcagattgccagcatcatcaggtactcatg .....
position 137
NR_038946.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC100506025 (LOC100506025), transcript variant 2, non-coding RNA. (2083 bp)
..... cattctggaagttggaagtacaagatcagattgccagcatcatcagatttgatat .....
position 215
NR_038947.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 3, non-coding RNA. (2787 bp)
..... tggtgtgattggacgctgtgcaggatgagattgccaaggaagagcttagaagtag .....
position 299
Synonym: BLOS2; RP11-316M21.4
NR_046314.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 4, non-coding RNA. (4544 bp)
..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....
position 2011
NR_047565.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 5, non-coding RNA. (3522 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1287
Synonym: MS4A16; NYD-SP21
NR_049731.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 6, non-coding RNA. (3474 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1239
Synonym: MS4A16; NYD-SP21
NR_049732.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 7, non-coding RNA. (3423 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1188
Synonym: MS4A16; NYD-SP21
NR_049733.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 8, non-coding RNA. (3573 bp)
..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....
position 1338
Synonym: MS4A16; NYD-SP21
NR_049734.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 3, non-coding RNA. (3494 bp)
..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....
position 2410
Synonym: Fbw10; HREP; SM25H2; SM2SH2
NR_051988.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SUZ RNA binding domain containing 1 pseudogene (LOC100130075), non-coding RNA. (1058 bp)
..... acagcgcagataaatgcaggcaagaagagatggcgcgactgccgcgtcaacgcgt .....
position 499
NR_073494.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GATA6 antisense RNA 1 (head to head) (GATA6-AS1), non-coding RNA. (1788 bp)
..... tgcgatcgaatgcgcgactcccagaagagatagccaggcgtccgcccggccgctc .....
position 1005
NR_102763.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens ankyrin repeat domain 36C, transcript variant 1 (ANKRD36C), mRNA. (6351 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....
position 5146 (CDS: 526 - 6351)
XM_001717763.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens ankyrin repeat domain 36C, transcript variant 2 (ANKRD36C), mRNA. (4623 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....
position 3418 (CDS: 526 - 4623)
XM_003118857.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens ankyrin repeat domain 36C (ANKRD36C), mRNA. (6306 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....
position 5101 (CDS: 1 - 6306)
XM_003119864.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens glutamate receptor, ionotropic, N-methyl-D-aspartate 3B (GRIN3B), mRNA. (3547 bp)
..... agcagcgccgaggcgtacatcaagaagagcttccccgacatgcacgcacacatgc .....
position 2403 (CDS: 1 - 3417)
XM_003403700.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens ankyrin repeat domain 36C (ANKRD36C), mRNA. (6356 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgcctggctcaggctggaaaaaga .....
position 5151 (CDS: 525 - 6356)
XM_003960295.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens ankyrin repeat domain 36B (ANKRD36B), mRNA. (4163 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgcctggctcaggctggaaaaaga .....
position 3258 (CDS: 561 - 4163)
XM_003960306.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC101060595 (LOC101060595), misc_RNA. (595 bp)
..... atgtcccgctctcccctgctcaaggagagagtgcctgacctgagctgggcccatc .....
position 393
XR_171205.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens ankyrin repeat domain-containing protein 36A-like (LOC100996862), misc_RNA. (1143 bp)
..... tgcatgaaaaccgcttgatgcaagatgaaattgcctggctcaggctggaaaaaga .....
position 88
XR_172491.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.011 | 0.011 | q_start
0.246 | 0.235 | q_end
0.811 | 0.565 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.