GGRNA Home | Help | Advanced search

2019-02-19 01:19:33, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
[AND] 3 NM_001277126, NM_001277129, NM_144687


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant 3, mRNA. (3883 bp)
..... atttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgct .....
position 3354 (CDS: 230 - 3418)
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
NM_001277126.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant 4, mRNA. (3709 bp)
..... atttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgct .....
position 3180 (CDS: 230 - 3244)
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
NM_001277129.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant 2, mRNA. (3880 bp)
..... atttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgct .....
position 3351 (CDS: 230 - 3415)
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
NM_144687.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.032 | 0.032 | q_start
0.100 | 0.068 | q_end
0.221 | 0.121 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.