GGRNA Home | Help | Advanced search

2018-10-20 19:54:26, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
[AND] 1 NM_032753


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), mRNA. (2190 bp)
..... cagcaggagggggccctgaggcatgggatgggacagtctgggccagcgccacctcccgggacagaagtgcggcaccagggcaggagctgcagtagctaccctccccgtctccagcctgggctccccagatcactcccagatcaccaggtcaccccatctctaggcggcacctcacacaccagtcctgtgg ..... ccaacgccccgccatcacccaatgtcaccgcacaccaggcagtggggacacggcagtaagcacaagaaagatttttttttttaaagctaaacca ..... ggtgacacagcaagaccccatctccacaaacgtttttaaaatgtgccgggtgtactggtgcacacctgtcatcccagctacccaa .....
position 1592 1634 1650 1698 1717 1783 1807 1812 1955 1972 1975 (CDS: 69 - 623)
Synonym: ARMD6; CORD11; QRX; RAXL1
NM_032753.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.088 | 0.088 | q_start
0.187 | 0.099 | q_start
0.193 | 0.006 | q_start
0.198 | 0.005 | q_start
0.203 | 0.005 | q_start
0.208 | 0.005 | q_start
0.213 | 0.005 | q_start
0.218 | 0.005 | q_start
0.224 | 0.006 | q_start
0.229 | 0.005 | q_start
0.234 | 0.005 | q_start
0.238 | 0.004 | q_end
0.286 | 0.048 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.