GGRNA Home | Help | Advanced search

2018-07-19 06:55:41, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
[AND] 1 NM_032753


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), mRNA. (2190 bp)
..... cagcaggagggggccctgaggcatgggatgggacagtctgggccagcgccacctcccgggacagaagtgcggcaccagggcaggagctgcagtagctaccctccccgtctccagcctgggctccccagatcactcccagatcaccaggtcaccccatctctaggcggcacctcacacaccagtcctgtgg ..... ccaacgccccgccatcacccaatgtcaccgcacaccaggcagtggggacacggcagtaagcacaagaaagatttttttttttaaagctaaacca ..... ggtgacacagcaagaccccatctccacaaacgtttttaaaatgtgccgggtgtactggtgcacacctgtcatcccagctacccaa .....
position 1592 1634 1650 1698 1717 1783 1807 1812 1955 1972 1975 (CDS: 69 - 623)
Synonym: ARMD6; CORD11; QRX; RAXL1
NM_032753.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.194 | 0.194 | q_start
0.606 | 0.412 | q_start
0.611 | 0.005 | q_start
0.615 | 0.004 | q_start
0.620 | 0.005 | q_start
0.625 | 0.005 | q_start
0.629 | 0.004 | q_start
0.633 | 0.004 | q_start
0.637 | 0.004 | q_start
0.642 | 0.005 | q_start
0.647 | 0.005 | q_start
0.650 | 0.003 | q_end
0.718 | 0.068 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.