GGRNA Home | Help | Advanced search

2018-07-19 06:59:36, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
iubcomp:aggtcannrtgacct11 NM_001252036, NM_001252037, NM_002868, NR_047658, NM_001080517, NM_001042482, NM_022445, NM_001145357, NM_001145358, NM_015477, NR_073388
[AND] 11 NM_001252036, NM_001252037, NM_002868, NR_047658, NM_001080517, NM_001042482, NM_022445, NM_001145357, NM_001145358, NM_015477, NR_073388


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 2, mRNA. (5299 bp)
..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....
position 2615 (CDS: 181 - 828)
NM_001252036.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 3, mRNA. (5217 bp)
..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....
position 2533 (CDS: 222 - 746)
NM_001252037.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 1, mRNA. (5340 bp)
..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....
position 2656 (CDS: 222 - 869)
NM_002868.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens KAT8 regulatory NSL complex subunit 3 (KANSL3), transcript variant 7, non-coding RNA. (4994 bp)
..... tttgcagacgctgaaggggaaggtcattttgaccttttgtgggtagcatggaatt .....
position 733
Synonym: KIAA1310; NSL3; Rcd1
NR_047658.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SET domain containing 5 (SETD5), mRNA. (6827 bp)
..... agaccttccctactcaactcaggtcattctgacctggctcctcatccctccctcg .....
position 3252 (CDS: 436 - 4764)
NM_001080517.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens thiamin pyrophosphokinase 1 (TPK1), transcript variant 2, mRNA. (2302 bp)
..... tggggtgttagaagtgcaccaggtcactctgaccttattactgtctttggtattg .....
position 1194 (CDS: 104 - 688)
Synonym: HTPK1; PP20; THMD5
NM_001042482.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens thiamin pyrophosphokinase 1 (TPK1), transcript variant 1, mRNA. (2449 bp)
..... tggggtgttagaagtgcaccaggtcactctgaccttattactgtctttggtattg .....
position 1341 (CDS: 104 - 835)
Synonym: HTPK1; PP20; THMD5
NM_022445.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SIN3 transcription regulator homolog A (yeast) (SIN3A), transcript variant 3, mRNA. (6620 bp)
..... tccccgtgttccctcaagaaaggtcatgttgacctggaaccataggggaaattgg .....
position 6209 (CDS: 183 - 4004)
NM_001145357.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SIN3 transcription regulator homolog A (yeast) (SIN3A), transcript variant 1, mRNA. (6795 bp)
..... tccccgtgttccctcaagaaaggtcatgttgacctggaaccataggggaaattgg .....
position 6384 (CDS: 358 - 4179)
NM_001145358.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SIN3 transcription regulator homolog A (yeast) (SIN3A), transcript variant 2, mRNA. (6697 bp)
..... tccccgtgttccctcaagaaaggtcatgttgacctggaaccataggggaaattgg .....
position 6286 (CDS: 260 - 4081)
NM_015477.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens asparagine-linked glycosylation 1-like 9, pseudogene (ALG1L9P), transcript variant 1, non-coding RNA. (1007 bp)
..... agggaccagcggacagttccaggtcatgctgacctcagcagaagggcgaggccag .....
position 853
NR_073388.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.012 | 0.012 | q_start
0.194 | 0.182 | q_end
0.211 | 0.017 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.