GGRNA Home | Help | Advanced search

2017-07-25 07:34:38, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:hits:results:
iub:aggtcannrtgacct3 NM_001252036, NM_001252037, NM_002868
[AND] 3 NM_001252036, NM_001252037, NM_002868

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 2, mRNA. (5299 bp)
..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....
position 2615 (CDS: 181 - 828)
NM_001252036.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 3, mRNA. (5217 bp)
..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....
position 2533 (CDS: 222 - 746)
NM_001252037.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 1, mRNA. (5340 bp)
..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....
position 2656 (CDS: 222 - 869)
NM_002868.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.087 | 0.087 | q_start
0.281 | 0.194 | q_end
0.285 | 0.004 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.