GGRNA | Results

2023-09-24 15:26:03, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:	hits:	results:
iub:aggtcannrtgacct	3	NM_001252036, NM_001252037, NM_002868
[AND]	3	NM_001252036, NM_001252037, NM_002868

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 2, mRNA. (5299 bp)

..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....

position 2615 (CDS: 181 - 828)

NM_001252036.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 3, mRNA. (5217 bp)

..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....

position 2533 (CDS: 222 - 746)

NM_001252037.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 1, mRNA. (5340 bp)

..... ttgggaaagaaagaaaggaaaggtcacagtgacctaggattggaaccttcctgcc .....

position 2656 (CDS: 222 - 869)

NM_002868.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

[GGRNA | 2023-09-24 15:26:03 | RefSeq release 60 (20130726)]
RefSeq ID	Version	Symbol	GeneID	Definition
NM_001252036	NM_001252036.1	RAB5B	5869	Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 2, mRNA.	position 2615 (CDS: 181 - 828) 
NM_001252037	NM_001252037.1	RAB5B	5869	Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 3, mRNA.	position 2533 (CDS: 222 - 746) 
NM_002868	NM_002868.3	RAB5B	5869	Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 1, mRNA.	position 2656 (CDS: 222 - 869)

Debug Info:

0.012 | 0.012 | q_start
0.206 | 0.194 | q_end
0.209 | 0.003 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.