GGRNA Home | Help | Advanced search

2018-10-20 20:37:44, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
comp3:caaggagagatgggacac94 NM_000335, NM_000376, NM_000602, NM_001005487, NM_001008723, NM_001013736, NM_001017535, NM_001017536, NM_001025194, NM_001025195, NM_001039508, NM_001042355, NM_001042412, NM_001079559, NM_001079670, [...]
[AND] 94 NM_000335, NM_000376, NM_000602, NM_001005487, NM_001008723, NM_001013736, NM_001017535, NM_001017536, NM_001025194, NM_001025195, NM_001039508, NM_001042355, NM_001042412, NM_001079559, NM_001079670, [...]


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 2, mRNA. (8501 bp)
..... ccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggcccc .....
position 1560 (CDS: 195 - 6242)
Synonym: CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1
NM_000335.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor (VDR), transcript variant 1, mRNA. (4669 bp)
..... acccttctgtgaccctagagctgtcccagctctccatgctgccccacctggctgacct .....
position 821 (CDS: 161 - 1444)
Synonym: NR1I1
NM_000376.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 (SERPINE1), mRNA. (3207 bp)
..... gagtgaatgtcccccatcatgtggcccaactctcctggcctggccatctccctcccca .....
position 1951 (CDS: 158 - 1366)
Synonym: PAI; PAI-1; PAI1; PLANH1
NM_000602.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens olfactory receptor, family 13, subfamily G, member 1 (OR13G1), mRNA. (924 bp)
..... ccatttcatatgcaggctgcatgtcccagctcttcttgttcacatggtctctgggagc .....
position 283 (CDS: 1 - 924)
Synonym: OR1-37
NM_001005487.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 147 (CCDC147), mRNA. (3313 bp)
..... aagtatttttgaaatgcaatgtgtcccctctcaccttattaacaataatctattttaa .....
position 3101 (CDS: 135 - 2753)
Synonym: bA127L20.4; bA127L20.5; bA554P13.1; C10orf80; RP11-554P13.1
NM_001008723.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 47, member C (FAM47C), mRNA. (3308 bp)
..... tggagcctcccgagactggagtgtcccatctctacctggagcctcctgggactggagt ..... cagagcctcccgagactggagtgtcccatctctgcccggaacctccagagactcgcgt ..... agctgcctcccgaggctggagtgtcccatctctgcccggaacctcccaagactcgcgt ..... cggagcctcccaagattggagtgtcccatctctgcctggagcctcccaagactcgcgg ..... tggagcctcctgagactggagtgtcccatctctg .....
position 851 1103 1175 1319 1463 1859 2075 (CDS: 53 - 3160)
NM_001013736.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor (VDR), transcript variant 2, mRNA. (4791 bp)
..... acccttctgtgaccctagagctgtcccagctctccatgctgccccacctggctgacct .....
position 943 (CDS: 283 - 1566)
Synonym: NR1I1
NM_001017535.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor (VDR), transcript variant 3, mRNA. (5060 bp)
..... acccttctgtgaccctagagctgtcccagctctccatgctgccccacctggctgacct .....
position 1212 (CDS: 402 - 1835)
Synonym: NR1I1
NM_001017536.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens carboxylesterase 1 (CES1), transcript variant 2, mRNA. (2024 bp)
..... gatagcagatgtgatgtttggtgtcccatctgtgattgtggcccggaaccacagagat .....
position 1388 (CDS: 109 - 1812)
Synonym: ACAT; CE-1; CEH; CES2; hCE-1; HMSE; HMSE1; PCE-1; REH; SES1; TGH
NM_001025194.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens carboxylesterase 1 (CES1), transcript variant 1, mRNA. (2027 bp)
..... gatagcagatgtgatgtttggtgtcccatctgtgattgtggcccggaaccacagagat .....
position 1391 (CDS: 109 - 1815)
Synonym: ACAT; CE-1; CEH; CES2; hCE-1; HMSE; HMSE1; PCE-1; REH; SES1; TGH
NM_001025195.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens signal-regulatory protein gamma (SIRPG), transcript variant 3, mRNA. (1387 bp)
..... gctctcaggtcatctgcgaggtggcccatgtcaccttgcagggggaccctcttcgtgg .....
position 747 (CDS: 66 - 896)
Synonym: bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma
NM_001039508.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cylindromatosis (turban tumor syndrome) (CYLD), transcript variant 2, mRNA. (8584 bp)
..... catacatagagaggctaaatgtgtcccatccctcactgtcagctttataaaggagttt .....
position 6010 (CDS: 279 - 3140)
NM_001042355.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cylindromatosis (turban tumor syndrome) (CYLD), transcript variant 3, mRNA. (8608 bp)
..... catacatagagaggctaaatgtgtcccatccctcactgtcagctttataaaggagttt .....
position 6034 (CDS: 303 - 3164)
NM_001042412.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens heterogeneous nuclear ribonucleoprotein U-like 2 (HNRNPUL2), mRNA. (5156 bp)
..... ggtgggctgggaggcttacagtgtcccaactctccattttcctgtgcctttgtgctgt .....
position 3093 (CDS: 230 - 2473)
Synonym: HNRPUL2; SAF-A2
NM_001079559.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calcium binding protein 39-like (CAB39L), transcript variant 2, mRNA. (3538 bp)
..... cagtgctccctctcagctcagtctcccctctctccctgtcctgcattccatcccagct .....
position 1910 (CDS: 346 - 1359)
Synonym: bA103J18.3; MO25-BETA; MO2L; RP11-103J18.3
NM_001079670.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WAS/WASL interacting protein family, member 3 (WIPF3), mRNA. (4195 bp)
..... ggagaaatctcaggaatgtggcatcccatctccccttgagacctatcactgaattcac .....
position 3906 (CDS: 183 - 1634)
Synonym: CR16
NM_001080529.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 3, mRNA. (8504 bp)
..... ccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggcccc .....
position 1560 (CDS: 195 - 6245)
Synonym: CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1
NM_001099404.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 4, mRNA. (8450 bp)
..... ccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggcccc .....
position 1560 (CDS: 195 - 6191)
Synonym: CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1
NM_001099405.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens C-type lectin domain family 1, member B (CLEC1B), transcript variant 2, mRNA. (883 bp)
..... ataagcaaaggaaaacaaatgtgtcccatctcacatggttctaccctactaaagacag .....
position 66 (CDS: 201 - 791)
Synonym: 1810061I13Rik; CLEC2; CLEC2B; PRO1384; QDED721
NM_001099431.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens OTU domain containing 4 (OTUD4), transcript variant 3, mRNA. (7068 bp)
..... tcctctcaaatcttcaactcttgccccatgtctccttggcagcaggatgctggcatct .....
position 5980 (CDS: 139 - 3288)
Synonym: DUBA6; HIN1; HSHIN1
NM_001102653.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eva-1 homolog A (C. elegans) (EVA1A), transcript variant 1, mRNA. (1872 bp)
..... aggatggcagtgaggacaccgtgtccgatctctccgtgcggagacaccgccgcttcga .....
position 752 (CDS: 479 - 937)
Synonym: FAM176A; TMEM166
NM_001135032.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transketolase (TKT), transcript variant 2, mRNA. (2957 bp)
..... ggtcctgggccaggacctgggtgtcccaagtccccttggaatcacctgcaactgccct .....
position 2127 (CDS: 173 - 2044)
Synonym: TK; TKT1
NM_001135055.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lactate dehydrogenase A-like 6A (LDHAL6A), transcript variant 2, mRNA. (1990 bp)
..... aaatgaagacatattccttagtgtcccatgtatcctgggagagaatggtatcacagac .....
position 1130 (CDS: 262 - 1260)
Synonym: LDH6A
NM_001144071.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 5, mRNA. (8406 bp)
..... ccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggcccc .....
position 1561 (CDS: 196 - 6147)
Synonym: CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1
NM_001160160.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 6, mRNA. (8343 bp)
..... ccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggcccc .....
position 1561 (CDS: 196 - 6084)
Synonym: CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1
NM_001160161.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens pre T-cell antigen receptor alpha (PTCRA), transcript variant 1, mRNA. (1142 bp)
..... cggatggcacctggaccaacttggcccatctctccctgccttctgaggagctggcatc .....
position 346 (CDS: 82 - 972)
Synonym: PT-ALPHA; PTA
NM_001243168.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens pre T-cell antigen receptor alpha (PTCRA), transcript variant 3, mRNA. (1022 bp)
..... cggatggcacctggaccaacttggcccatctctccctgccttctgaggagctggcatc .....
position 271 (CDS: 82 - 852)
Synonym: PT-ALPHA; PTA
NM_001243169.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamine--fructose-6-phosphate transaminase 1 (GFPT1), transcript variant 1, mRNA. (8703 bp)
..... acattgttgtcctctttccagtgtcgcatctgtcattggtttttcactatggcaagtt .....
position 8364 (CDS: 184 - 2283)
NM_001244710.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polycomb group ring finger 5 (PCGF5), transcript variant 2, mRNA. (7164 bp)
..... gaggaagttccatatcccccttgtaccatttctccttgggaactcatgctatgggcta .....
position 5432 (CDS: 361 - 1131)
Synonym: RNF159
NM_001256549.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant N2BA, mRNA. (104301 bp)
..... gacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaag .....
position 68921 (CDS: 226 - 103278)
NM_001256850.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polycomb group ring finger 5 (PCGF5), transcript variant 4, mRNA. (7057 bp)
..... gaggaagttccatatcccccttgtaccatttctccttgggaactcatgctatgggcta .....
position 5325 (CDS: 254 - 1024)
Synonym: RNF159
NM_001257101.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens carboxylesterase 1 (CES1), transcript variant 3, mRNA. (2021 bp)
..... gatagcagatgtgatgtttggtgtcccatctgtgattgtggcccggaaccacagagat .....
position 1385 (CDS: 109 - 1809)
Synonym: ACAT; CE-1; CEH; CES2; hCE-1; HMSE; HMSE1; PCE-1; REH; SES1; TGH
NM_001266.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant IC, mRNA. (109224 bp)
..... gacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaag .....
position 73844 (CDS: 226 - 108201)
NM_001267550.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 839 (ZNF839), transcript variant 2, mRNA. (3781 bp)
..... ctgatgattggccctgctccgtttcccttctctcctgggagatatgctgcttttccac .....
position 3123 (CDS: 351 - 2786)
Synonym: C14orf131
NM_001267827.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 839 (ZNF839), transcript variant 3, mRNA. (3712 bp)
..... ctgatgattggccctgctccgtttcccttctctcctgggagatatgctgcttttccac .....
position 3054 (CDS: 282 - 2717)
Synonym: C14orf131
NM_001267828.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens testis highly expressed protein 5 (THEG5), transcript variant 4, mRNA. (1519 bp)
..... acaggtcaataatgaaactcgtggcccatctgtccttccggtgtgccctgcactgtgc .....
position 145 (CDS: 570 - 992)
NM_001278577.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamine--fructose-6-phosphate transaminase 1 (GFPT1), transcript variant 2, mRNA. (8649 bp)
..... acattgttgtcctctttccagtgtcgcatctgtcattggtttttcactatggcaagtt .....
position 8310 (CDS: 184 - 2229)
NM_002056.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB3B, member RAS oncogene family (RAB3B), mRNA. (12844 bp)
..... tcatttcctgtaataagcagctgtcacctctctccttgtttcttccagaaatagtaat .....
position 8839 (CDS: 214 - 873)
NM_002867.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 (SMARCA1), transcript variant 1, mRNA. (4102 bp)
..... gatgaatgaatttaaacgatgggtcccatctctccgtgtcatttgttttgtcggagac .....
position 874 (CDS: 114 - 3278)
NM_003069.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant N2-B, mRNA. (82029 bp)
..... gacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaag .....
position 46649 (CDS: 226 - 81006)
NM_003319.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Fanconi anemia, complementation group G (FANCG), mRNA. (2649 bp)
..... cggcgggccgcggggagagagcgtcccatctgtcctggaaagcctgggcgggtggatt .....
position 317 (CDS: 493 - 2361)
Synonym: FAG; XRCC9
NM_004629.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Hermansky-Pudlak syndrome 5 (HPS5), transcript variant 2, mRNA. (4723 bp)
..... gtttgcacctaaatgggaaagtctcacatctctccctgatatctgtggagcgctgtgt .....
position 1166 (CDS: 464 - 3511)
Synonym: AIBP63
NM_007216.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3-domain binding protein 4 (SH3BP4), mRNA. (5193 bp)
..... gggacgccatgcgagccagcgtctcccttctctcctggacagaaggccgtgtcctggg .....
position 189 (CDS: 394 - 3285)
Synonym: BOG25; TTP
NM_014521.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WSC domain containing 2 (WSCD2), mRNA. (4650 bp)
..... tgacttaagagagagccccagtgacacatctctccatggtgggctccagtcagtctta .....
position 3286 (CDS: 745 - 2442)
NM_014653.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 350kDa (CEP350), mRNA. (13473 bp)
..... tgattctctacgaagtgatagtgttccatctcttcctgatgaaaaagactcaacgtct .....
position 5149 (CDS: 384 - 9737)
Synonym: CAP350; GM133
NM_014810.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens syntaxin binding protein 5-like (STXBP5L), mRNA. (9382 bp)
..... tcctttgcacggaaaaatgactctaccatctctccttgtctgttcgttggaaccagtc .....
position 2678 (CDS: 141 - 3701)
Synonym: LLGL4
NM_014980.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cylindromatosis (turban tumor syndrome) (CYLD), transcript variant 1, mRNA. (8730 bp)
..... catacatagagaggctaaatgtgtcccatccctcactgtcagctttataaaggagttt .....
position 6156 (CDS: 416 - 3286)
NM_015247.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens C-type lectin domain family 1, member B (CLEC1B), transcript variant 1, mRNA. (982 bp)
..... ataagcaaaggaaaacaaatgtgtcccatctcacatggttctaccctactaaagacag .....
position 66 (CDS: 201 - 890)
Synonym: 1810061I13Rik; CLEC2; CLEC2B; PRO1384; QDED721
NM_016509.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 5, mRNA. (14100 bp)
..... agccttttctgtactttattgtgtcccagccttccttgcttctgagttgtcaccacag .....
position 5986 (CDS: 112 - 12180)
Synonym: CHS1; COH1
NM_017890.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vacuolar protein sorting 37 homolog C (S. cerevisiae) (VPS37C), mRNA. (2711 bp)
..... caccggcccctttcccagtagtgtcccagccctccttctacagcgggcctctgggccc .....
position 751 (CDS: 61 - 1128)
NM_017966.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 839 (ZNF839), transcript variant 1, mRNA. (3794 bp)
..... ctgatgattggccctgctccgtttcccttctctcctgggagatatgctgcttttccac .....
position 3136 (CDS: 16 - 2799)
Synonym: C14orf131
NM_018335.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens signal-regulatory protein gamma (SIRPG), transcript variant 1, mRNA. (1720 bp)
..... gctctcaggtcatctgcgaggtggcccatgtcaccttgcagggggaccctcttcgtgg .....
position 747 (CDS: 66 - 1229)
Synonym: bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma
NM_018556.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin beta 15 (PCDHB15), mRNA. (2891 bp)
..... gcacagatcgatcactgcctctgtcccatcgctccctgaagtagctctgactccggtt .....
position 164 (CDS: 231 - 2594)
Synonym: PCDH-BETA15
NM_018935.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRC kinase signaling inhibitor 1 (SRCIN1), mRNA. (7050 bp)
..... tggcctctcgctggccgcacctgtcacatctctccttcttctctttcaccactctttc .....
position 4074 (CDS: 226 - 3777)
Synonym: P140; SNIP
NM_025248.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calcium binding protein 39-like (CAB39L), transcript variant 1, mRNA. (3691 bp)
..... cagtgctccctctcagctcagtctcccctctctccctgtcctgcattccatcccagct .....
position 2063 (CDS: 499 - 1512)
Synonym: bA103J18.3; MO25-BETA; MO2L; RP11-103J18.3
NM_030925.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eva-1 homolog A (C. elegans) (EVA1A), transcript variant 2, mRNA. (1832 bp)
..... aggatggcagtgaggacaccgtgtccgatctctccgtgcggagacaccgccgcttcga .....
position 712 (CDS: 439 - 897)
Synonym: FAM176A; TMEM166
NM_032181.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polycomb group ring finger 5 (PCGF5), transcript variant 1, mRNA. (7222 bp)
..... gaggaagttccatatcccccttgtaccatttctccttgggaactcatgctatgggcta .....
position 5490 (CDS: 419 - 1189)
Synonym: RNF159
NM_032373.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNK lysine deficient protein kinase 4 (WNK4), mRNA. (4194 bp)
..... gggtgccatccagcctggctgagtcccatctctgcctgccctcggcttttgccctatc .....
position 1908 (CDS: 69 - 3800)
Synonym: PHA2B; PRKWNK4
NM_032387.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fibrillin 3 (FBN3), mRNA. (8967 bp)
..... aactgcacagatatcgacgagtgtcgcatctctcctgacctctgcggccagggcacct .....
position 3114 (CDS: 22 - 8451)
NM_032447.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tigger transposable element derived 5 (TIGD5), mRNA. (2412 bp)
..... agggaggggacatacacacagtctcccatctctcctcccctccccctggggtggccca .....
position 1988 (CDS: 1 - 1929)
NM_032862.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 97 (CCDC97), mRNA. (3344 bp)
..... gagcctccttgcttctgttaggttcccatctctccttctgcctcactctgggcctctt .....
position 1712 (CDS: 123 - 1154)
NM_052848.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant N2-A, mRNA. (101520 bp)
..... gacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaag .....
position 66140 (CDS: 226 - 100497)
NM_133378.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant novex-1, mRNA. (82404 bp)
..... gacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaag .....
position 47024 (CDS: 226 - 81381)
NM_133432.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens titin (TTN), transcript variant novex-2, mRNA. (82605 bp)
..... gacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaag .....
position 47225 (CDS: 226 - 81582)
NM_133437.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens pre T-cell antigen receptor alpha (PTCRA), transcript variant 2, mRNA. (1097 bp)
..... cggatggcacctggaccaacttggcccatctctccctgccttctgaggagctggcatc .....
position 346 (CDS: 82 - 927)
Synonym: PT-ALPHA; PTA
NM_138296.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 1, mRNA. (4966 bp)
..... gctggtgcggcccgaggccagtgtcccctgtctcattgccgactgcacctaccgctgg .....
position 3635 (CDS: 445 - 4728)
Synonym: ADAM-TS13; ADAMTS-13; C9orf8; vWF-CP; VWFCP
NM_139025.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 3, mRNA. (4705 bp)
..... gctggtgcggcccgaggccagtgtcccctgtctcattgccgactgcacctaccgctgg .....
position 3542 (CDS: 445 - 4467)
Synonym: ADAM-TS13; ADAMTS-13; C9orf8; vWF-CP; VWFCP
NM_139026.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 2, mRNA. (4798 bp)
..... gctggtgcggcccgaggccagtgtcccctgtctcattgccgactgcacctaccgctgg .....
position 3635 (CDS: 445 - 4560)
Synonym: ADAM-TS13; ADAMTS-13; C9orf8; vWF-CP; VWFCP
NM_139027.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 (SMARCA1), transcript variant 2, mRNA. (4066 bp)
..... gatgaatgaatttaaacgatgggtcccatctctccgtgtcatttgttttgtcggagac .....
position 874 (CDS: 114 - 3242)
NM_139035.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens septin 10 (SEPT10), transcript variant 1, mRNA. (3256 bp)
..... ttcctcgcgccgtcttcctggagtcccagctctccttcagcccgccccaacgctgacg .....
position 73 (CDS: 380 - 1744)
NM_144710.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lactate dehydrogenase A-like 6A (LDHAL6A), transcript variant 1, mRNA. (2583 bp)
..... aaatgaagacatattccttagtgtcccatgtatcctgggagagaatggtatcacagac .....
position 1723 (CDS: 855 - 1853)
Synonym: LDH6A
NM_144972.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 1, mRNA. (14025 bp)
..... agccttttctgtactttattgtgtcccagccttccttgcttctgagttgtcaccacag .....
position 5911 (CDS: 112 - 12105)
Synonym: CHS1; COH1
NM_152564.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 47, member B (FAM47B), mRNA. (2122 bp)
..... cggagcctcccgaggctggagtgtcccatctctgcctggaacctcccaacactcatcg .....
position 1018 (CDS: 37 - 1974)
NM_152631.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal modification protein rimK-like family member A (RIMKLA), mRNA. (10583 bp)
..... ccacatctgattttataacagtttcccatcactccttaaagaaaaaggccaggccggg .....
position 3985 (CDS: 139 - 1314)
Synonym: FAM80A; NAAGS; NAAGS-II; RP11-157D18.1
NM_173642.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens septin 10 (SEPT10), transcript variant 2, mRNA. (3187 bp)
..... ttcctcgcgccgtcttcctggagtcccagctctccttcagcccgccccaacgctgacg .....
position 73 (CDS: 380 - 1675)
NM_178584.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Hermansky-Pudlak syndrome 5 (HPS5), transcript variant 1, mRNA. (4880 bp)
..... gtttgcacctaaatgggaaagtctcacatctctccctgatatctgtggagcgctgtgt .....
position 1323 (CDS: 279 - 3668)
Synonym: AIBP63
NM_181507.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Hermansky-Pudlak syndrome 5 (HPS5), transcript variant 3, mRNA. (4536 bp)
..... gtttgcacctaaatgggaaagtctcacatctctccctgatatctgtggagcgctgtgt .....
position 979 (CDS: 277 - 3324)
Synonym: AIBP63
NM_181508.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 1, mRNA. (8504 bp)
..... ccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggcccc .....
position 1560 (CDS: 195 - 6245)
Synonym: CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1
NM_198056.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kelch-like family member 17 (KLHL17), mRNA. (2581 bp)
..... ccttcctgtcgtcgtctgccgtgtgccatctttcctggatcttgtagtgggtgcacac .....
position 2461 (CDS: 108 - 2036)
Synonym: RP11-54O7.6
NM_198317.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens KCNQ1 opposite strand/antisense transcript 1 (non-protein coding) (KCNQ1OT1), non-coding RNA. (91671 bp)
..... ggcccagccctctccacctggagtgccatctctctttgtgggatgggccaggtgggct .....
position 11159
Synonym: KCNQ1-AS2; KCNQ10T1; KvDMR1; KvLQT1-AS; LIT1; NCRNA00012
NR_002728.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 225, member A (non-protein coding) (FAM225A), non-coding RNA. (5802 bp)
..... ttttgttagtggacctttccctggcccttctctccttggccccctcttggcaggagag .....
position 1342
Synonym: C9orf109; LINC00256A; NCRNA00256A
NR_024366.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 225, member B (non-protein coding) (FAM225B), non-coding RNA. (5836 bp)
..... ttttgttagtggacctttccctggcccttctctccttggccccctcttggcaggagag .....
position 1342
Synonym: C9orf110; LINC00256B; NCRNA00256B
NR_024376.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 4, non-coding RNA. (3004 bp)
..... gctggtgcggcccgaggccagtgtcccctgtctcattgccgactgcacctaccgctgg .....
position 2026
Synonym: ADAM-TS13; ADAMTS-13; C9orf8; vWF-CP; VWFCP
NR_024514.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MRVI1 antisense RNA 1 (MRVI1-AS1), transcript variant 3, non-coding RNA. (671 bp)
..... gccatggaaacagcctggcagactcccatctctcctggtgccatctccggagcggaaa .....
position 202
NR_034093.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MRVI1 antisense RNA 1 (MRVI1-AS1), transcript variant 4, non-coding RNA. (633 bp)
..... gccatggaaacagcctggcagactcccatctctcctggtgccatctccggagcggaaa .....
position 202
NR_034094.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MRVI1 antisense RNA 1 (MRVI1-AS1), transcript variant 1, non-coding RNA. (910 bp)
..... gccatggaaacagcctggcagactcccatctctcctggtgccatctccggagcggaaa .....
position 202
NR_046374.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MRVI1 antisense RNA 1 (MRVI1-AS1), transcript variant 2, non-coding RNA. (810 bp)
..... gccatggaaacagcctggcagactcccatctctcctggtgccatctccggagcggaaa .....
position 202
NR_046375.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens septin 10 (SEPT10), transcript variant 3, non-coding RNA. (2942 bp)
..... ttcctcgcgccgtcttcctggagtcccagctctccttcagcccgccccaacgctgacg .....
position 73
NR_047585.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens liver carboxylesterase 1-like (LOC100653057), mRNA. (1245 bp)
..... gatagcagatgtgatgtttggtgtcccatctgtgattgtggcccggaaccacagagat .....
position 623 (CDS: 1 - 1047)
XM_003403879.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128364 (LOC100128364), misc_RNA. (2209 bp)
..... tgtcccctcatcaccttctgatgtcccatcactccctgatgtcccattactccctggt .....
position 1763
XR_108776.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2261 bp)
..... ctgctaggaagcctctgtttgtgtctcatctctccaggtggactggagctcctggggg .....
position 726
XR_109667.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2260 bp)
..... ctgctaggaagcctctgtttgtgtctcatctctccaggtggactggagctcctggggg .....
position 725
XR_112184.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128364 (LOC100128364), misc_RNA. (2347 bp)
..... tgtcccctcatcaccttctgatgtcccatcactccctgatgtcccattactccctggt .....
position 1901
XR_171643.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2265 bp)
..... ctgctaggaagcctctgtttgtgtctcatctctccaggtggactggagctcctggggg .....
position 726
XR_172343.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.282 | 0.282 | q_start
0.924 | 0.642 | q_end
2.548 | 1.624 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.