GGRNA Home | Help | Advanced search

2018-04-24 17:21:25, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:hits:results:
comp2:caagaagagattgcc103 NM_000122, NM_000680, NM_000783, NM_001005243, NM_001005389, NM_001007075, NM_001008844, NM_001039548, NM_001040100, NM_001040451, NM_001040452, NM_001065, NM_001083617, NM_001098801, NM_001100399, [...]
[AND] 103 NM_000122, NM_000680, NM_000783, NM_001005243, NM_001005389, NM_001007075, NM_001008844, NM_001039548, NM_001040100, NM_001040451, NM_001040452, NM_001065, NM_001083617, NM_001098801, NM_001100399, [...]

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 3 (ERCC3), mRNA. (2751 bp)
..... ccctctgggtggctcccgatggccatatcttcttggaagccttctctccagttta .....
position 339 (CDS: 96 - 2444)
Synonym: BTF2; GTF2H; RAD25; TFIIH; XPB
NM_000122.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens adrenoceptor alpha 1A (ADRA1A), transcript variant 1, mRNA. (2281 bp)
..... accccacttccttctcggaaggccagctcttcttggaggacaagacaggaccaat .....
position 1901 (CDS: 437 - 1837)
Synonym: ADRA1C; ADRA1L1; ALPHA1AAR
NM_000680.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 1, mRNA. (2119 bp)
..... aggccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgccctt .....
position 700 (CDS: 46 - 1539)
Synonym: CP26; CYP26; P450RAI; P450RAI1
NM_000783.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens olfactory receptor, family 9, subfamily K, member 2 (OR9K2), mRNA. (1008 bp)
..... caccaatgtattttttcctaggcaatctctccttcattgatcttttctattcatc .....
position 265 (CDS: 1 - 1008)
Synonym: OR12-2
NM_001005243.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neurofascin (NFASC), transcript variant 5, mRNA. (2527 bp)
..... caagtggccgggtcaggcgtggtgatctcttcttgcctcgtgatgtcagggttag .....
position 2280 (CDS: 329 - 2188)
Synonym: NF; NRCAML
NM_001005389.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kelch-like family member 5 (KLHL5), transcript variant 3, mRNA. (7666 bp)
..... taaacttttggcttatattaggctacctcttcttgcaccacagttcctggcagac .....
position 1450 (CDS: 360 - 2489)
NM_001007075.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens desmoplakin (DSP), transcript variant 2, mRNA. (7933 bp)
..... atttgactgtgcatgacagcggcaatcttttctttggtcaaagttttctgtttat .....
position 7681 (CDS: 280 - 7098)
Synonym: DP; DPI; DPII
NM_001008844.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kelch-like family member 35 (KLHL35), mRNA. (1952 bp)
..... cggcggtggcgtcctgcgcgggcaagctcttcgtgattgggggcgccaggcaggg .....
position 1321 (CDS: 1 - 1752)
NM_001039548.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens serine palmitoyltransferase, small subunit B (SPTSSB), mRNA. (2306 bp)
..... gggaggggagtgttgcagcaggcattctcttctggaaggagtcgctgggagcagt .....
position 388 (CDS: 775 - 1005)
Synonym: ADMP; C3orf57; SSSPTB
NM_001040100.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 2, mRNA. (2674 bp)
..... tgggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 813 (CDS: 348 - 2150)
Synonym: RABIP4; ZFYVE12
NM_001040451.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 3, mRNA. (2485 bp)
..... tgggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 624 (CDS: 159 - 1961)
Synonym: RABIP4; ZFYVE12
NM_001040452.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A), mRNA. (2258 bp)
..... cgaaaggaaatgggtcaggtggagatctcttcttgcacagtggaccgggacaccg .....
position 639 (CDS: 304 - 1671)
Synonym: CD120a; FPF; MS5; p55; p55-R; p60; TBP1; TNF-R; TNF-R-I; TNF-R55; TNFAR; TNFR1; TNFR1-d2; TNFR55; TNFR60
NM_001065.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RB1-inducible coiled-coil 1 (RB1CC1), transcript variant 2, mRNA. (6661 bp)
..... agcccagcagaaggagaccttgaaatctcttcttgaacaagagacagaaaatttg .....
position 3824 (CDS: 559 - 5334)
Synonym: CC1; FIP200
NM_001083617.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 210, member A (FAM210A), transcript variant 1, mRNA. (4392 bp)
..... ttaaatgaatatgctgtgattggaatctcttcttgggggccggggagagtgctga .....
position 3043 (CDS: 433 - 1251)
Synonym: C18orf19; HsT2329
NM_001098801.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) (PDS5A), transcript variant 1, mRNA. (7190 bp)
..... aacacagaatcgtcctctttggcaatgttttcttggacgatttaatgatattcat .....
position 1514 (CDS: 541 - 4554)
Synonym: PIG54; SCC-112; SCC112
NM_001100399.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) (PDS5A), transcript variant 3, mRNA. (2745 bp)
..... aacacagaatcgtcctctttggcaatgttttcttggacgatttaatgatattcat .....
position 1514 (CDS: 541 - 2343)
Synonym: PIG54; SCC-112; SCC112
NM_001100400.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 (DDX54), transcript variant 1, mRNA. (4404 bp)
..... actacagcttccccgccaagggcaaactcttcctgcaccgcgtgggccgtgtggc .....
position 1283 (CDS: 29 - 2677)
Synonym: DP97
NM_001111322.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens human immunodeficiency virus type I enhancer binding protein 3 (HIVEP3), transcript variant 2, mRNA. (12325 bp)
..... ccaggttagaaatctgcctgggcaagctcttcctgccccagacctacaaagcagc .....
position 10464 (CDS: 1016 - 8233)
Synonym: KBP-1; KBP1; KRC; Schnurri-3; SHN3; ZAS3; ZNF40C
NM_001127714.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neuronal calcium sensor 1 (NCS1), transcript variant 2, mRNA. (4878 bp)
..... gcaaaaacaaacaaacaaaaggcaatgtcttctggttgtggttatttcctttcct .....
position 4625 (CDS: 10 - 528)
Synonym: FLUP; FREQ
NM_001128826.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens DENN/MADD domain containing 4A (DENND4A), transcript variant 1, mRNA. (7341 bp)
..... atactacatgcccattctgtggcaatatcttcttaccctttctgaatatagaaat .....
position 4964 (CDS: 386 - 6106)
Synonym: IRLB; MYCPBP
NM_001144823.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 880 (ZNF880), mRNA. (2285 bp)
..... agttcttacaaactgagtatggcaaactcttcatgctaagttctagcattaatca .....
position 1873 (CDS: 50 - 1783)
NM_001145434.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myotubularin related protein 11 (MTMR11), transcript variant 1, mRNA. (2879 bp)
..... cgggacagtccttccctgctggcagtctcttctcgttggctccctcgacctgcta .....
position 2006 (CDS: 252 - 2381)
Synonym: CRA; RP11-212K13.1
NM_001145862.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neurofascin (NFASC), transcript variant 6, mRNA. (2509 bp)
..... caagtggccgggtcaggcgtggtgatctcttcttgcctcgtgatgtcagggttag .....
position 2262 (CDS: 329 - 2170)
Synonym: NF; NRCAML
NM_001160333.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin 11 X-linked (PCDH11X), transcript variant e, mRNA. (8365 bp)
..... tttagaatattaaatgactgggcaccctcttcttggtttttaccagagaggcttt .....
position 6596 (CDS: 45 - 4064)
Synonym: PCDH-X; PCDH11; PCDHX
NM_001168360.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin 11 X-linked (PCDH11X), transcript variant f, mRNA. (8226 bp)
..... tttagaatattaaatgactgggcaccctcttcttggtttttaccagagaggcttt .....
position 6457 (CDS: 45 - 3242)
Synonym: PCDH-X; PCDH11; PCDHX
NM_001168361.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin 11 X-linked (PCDH11X), transcript variant g, mRNA. (8278 bp)
..... tttagaatattaaatgactgggcaccctcttcttggtttttaccagagaggcttt .....
position 6509 (CDS: 45 - 3977)
Synonym: PCDH-X; PCDH11; PCDHX
NM_001168362.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin 11 X-linked (PCDH11X), transcript variant h, mRNA. (8335 bp)
..... tttagaatattaaatgactgggcaccctcttcttggtttttaccagagaggcttt .....
position 6566 (CDS: 45 - 4034)
Synonym: PCDH-X; PCDH11; PCDHX
NM_001168363.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kelch-like family member 5 (KLHL5), transcript variant 4, mRNA. (7189 bp)
..... taaacttttggcttatattaggctacctcttcttgcaccacagttcctggcagac .....
position 973 (CDS: 306 - 2012)
NM_001171654.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens syntaxin 3 (STX3), transcript variant 2, mRNA. (6384 bp)
..... cagcactcagacagagccaaggcaatatcctcttgcccatggctatgatgtcaga .....
position 2959 (CDS: 548 - 1381)
Synonym: STX3A
NM_001178040.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens formyl peptide receptor 1 (FPR1), transcript variant 1, mRNA. (1371 bp)
..... ggacacctgctgtatctgctggctatctcttcctggatatcatcacttatctggt .....
position 207 (CDS: 147 - 1199)
Synonym: FMLP; FPR
NM_001193306.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 3, mRNA. (4739 bp)
..... ccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4030 (CDS: 107 - 574)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_001204869.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 4, mRNA. (4459 bp)
..... ccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 3750 (CDS: 107 - 475)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_001204870.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens BCL2-associated athanogene 4 (BAG4), transcript variant 2, mRNA. (4370 bp)
..... cagcgccctcagcaccacccggcaatctctacatgactgaaagtacttcaccatg .....
position 973 (CDS: 283 - 1548)
Synonym: BAG-4; SODD
NM_001204878.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptotagmin XIII (SYT13), transcript variant 2, mRNA. (5388 bp)
..... ctataagctgaaagctgaccagcattctcttcttggtaacatctactactccaat .....
position 3936 (CDS: 777 - 1625)
NM_001247987.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens shroom family member 2 (SHROOM2), mRNA. (7445 bp)
..... cggcgcttctcccggtgatcggcaatcactgcttgagaagcagagagtcctgatc .....
position 4673 (CDS: 91 - 4941)
Synonym: APXL; HSAPXL
NM_001649.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cannabinoid receptor 2 (macrophage) (CNR2), mRNA. (1789 bp)
..... ggaagagagagaggggtcttggcactctcttcttacttaaaccagtcccagacac .....
position 1283 (CDS: 128 - 1210)
Synonym: CB-2; CB2; CX5
NM_001841.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens formyl peptide receptor 1 (FPR1), transcript variant 2, mRNA. (1334 bp)
..... ggacacctgctgtatctgctggctatctcttcctggatatcatcacttatctggt .....
position 156 (CDS: 96 - 1148)
Synonym: FMLP; FPR
NM_002029.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2 (SLC9A2), mRNA. (5446 bp)
..... tttcacctctcaggcatcatggcaatcactgcttgtgcaatgactatgaataagt .....
position 1144 (CDS: 143 - 2581)
Synonym: NHE2
NM_003048.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eukaryotic translation initiation factor 3, subunit H (EIF3H), mRNA. (1286 bp)
..... agttcactgcccaaaacttaggcaagctcttcatggcccaggctcttcaagaata .....
position 1041 (CDS: 27 - 1085)
Synonym: eIF3-gamma; eIF3-p40; EIF3S3
NM_003756.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1, mRNA. (5194 bp)
..... ccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4485 (CDS: 107 - 1210)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_003882.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens syntaxin 3 (STX3), transcript variant 1, mRNA. (6498 bp)
..... cagcactcagacagagccaaggcaatatcctcttgcccatggctatgatgtcaga .....
position 3073 (CDS: 548 - 1417)
Synonym: STX3A
NM_004177.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cellular retinoic acid binding protein 1 (CRABP1), mRNA. (782 bp)
..... tgagaacaagatccactgcacgcaaactcttcttgaaggggacggccccaaaacc .....
position 395 (CDS: 106 - 519)
Synonym: CRABP; CRABP-I; CRABPI; RBP5
NM_004378.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens desmoplakin (DSP), transcript variant 1, mRNA. (9730 bp)
..... atttgactgtgcatgacagcggcaatcttttctttggtcaaagttttctgtttat .....
position 9478 (CDS: 280 - 8895)
Synonym: DP; DPI; DPII
NM_004415.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neural cell adhesion molecule 2 (NCAM2), mRNA. (5006 bp)
..... ggggttgcttgtcagtagcgggcaagctcttcttcaagtgacaatttcacttagc ..... taagttgcagggttaaatgcgggaatctctccttgcgttcctgtctggcgtattc .....
position 299 4503 (CDS: 250 - 2763)
Synonym: NCAM21
NM_004540.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TGFB1-induced anti-apoptotic factor 1 (TIAF1), mRNA. (2110 bp)
..... tccctctcgtgtggggtgggggctctctcttcttggtgcctgctgtctttctact .....
position 1280 (CDS: 1411 - 1758)
Synonym: MAJN; SPR210
NM_004740.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens BCL2-associated athanogene 4 (BAG4), transcript variant 1, mRNA. (4478 bp)
..... cagcgccctcagcaccacccggcaatctctacatgactgaaagtacttcaccatg .....
position 1081 (CDS: 283 - 1656)
Synonym: BAG-4; SODD
NM_004874.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens DENN/MADD domain containing 4A (DENND4A), transcript variant 2, mRNA. (7205 bp)
..... atactacatgcccattctgtggcaatatcttcttaccctttctgaatatagaaat .....
position 4828 (CDS: 379 - 5970)
Synonym: IRLB; MYCPBP
NM_005848.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calmodulin 1 (phosphorylase kinase, delta) (CALM1), mRNA. (4268 bp)
..... cacgaacccctcagcatactgggaatctcttcctgaacaacgaatgtaaatttgg .....
position 3717 (CDS: 249 - 698)
Synonym: CALML2; caM; CAMI; CPVT4; DD132; PHKD
NM_006888.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens abhydrolase domain containing 2 (ABHD2), transcript variant 1, mRNA. (9159 bp)
..... gaagatcatcctctcgcacaggcaagctctttttggagaccatgttaagaaaccc .....
position 1733 (CDS: 919 - 2196)
Synonym: HS1-2; LABH2; PHPS1-2
NM_007011.7 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens neuronal calcium sensor 1 (NCS1), transcript variant 1, mRNA. (5009 bp)
..... gcaaaaacaaacaaacaaaaggcaatgtcttctggttgtggttatttcctttcct .....
position 4756 (CDS: 87 - 659)
Synonym: FLUP; FREQ
NM_014286.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 2B (LCE2B), mRNA. (619 bp)
..... tgcccagctccatgttcccctgcagtctcttcttgctgtggtcccatctctgggg .....
position 180 (CDS: 55 - 387)
Synonym: LEP10; SPRL1B; XP5
NM_014357.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RB1-inducible coiled-coil 1 (RB1CC1), transcript variant 1, mRNA. (6670 bp)
..... agcccagcagaaggagaccttgaaatctcttcttgaacaagagacagaaaatttg .....
position 3824 (CDS: 559 - 5343)
Synonym: CC1; FIP200
NM_014781.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB GTPase activating protein 1-like (RABGAP1L), transcript variant 1, mRNA. (3022 bp)
..... agacattgggtactgtcaagggcagtcttttcttgctgctgtattactgctgcat .....
position 2142 (CDS: 278 - 2725)
Synonym: HHL; RP1-102G20.1; TBC1D18
NM_014857.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens pannexin 1 (PANX1), mRNA. (2782 bp)
..... ggtacaacgatttgagcctctacaatctcttcttggaggaaaatataagtgaggt .....
position 1376 (CDS: 386 - 1666)
Synonym: MRS1; PX1; UNQ2529
NM_015368.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kelch-like family member 5 (KLHL5), transcript variant 1, mRNA. (7728 bp)
..... taaacttttggcttatattaggctacctcttcttgcaccacagttcctggcagac .....
position 1512 (CDS: 284 - 2551)
NM_015990.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 120C (FAM120C), transcript variant 1, mRNA. (8090 bp)
..... gggctttcagccaatttggaggaaatctcttctggaactccagggtcaaattggt .....
position 4840 (CDS: 84 - 3374)
Synonym: CXorf17; ORF34
NM_017848.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tRNA methyltransferase 12 homolog (S. cerevisiae) (TRMT12), mRNA. (2232 bp)
..... cccgatcatggcaacggcatggtaatctcttgttgctgagtgaagactgtttcca .....
position 533 (CDS: 122 - 1468)
Synonym: TRM12; TYW2
NM_017956.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptotagmin XIII (SYT13), transcript variant 1, mRNA. (5184 bp)
..... ctataagctgaaagctgaccagcattctcttcttggtaacatctactactccaat .....
position 3718 (CDS: 127 - 1407)
NM_020826.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens contactin 3 (plasmacytoma associated) (CNTN3), mRNA. (4997 bp)
..... aaacccagagcctccccaagggcactctcttcctggaagaagggggatgtgagcg .....
position 1394 (CDS: 81 - 3167)
Synonym: BIG-1; PANG; PCS
NM_020872.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens reversion-inducing-cysteine-rich protein with kazal motifs (RECK), mRNA. (4427 bp)
..... cttgcctcaagatcctctttggcaatgttttcttgaaagctcacaatctgttcac .....
position 868 (CDS: 87 - 3002)
Synonym: ST15
NM_021111.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 (DDX54), transcript variant 2, mRNA. (4401 bp)
..... actacagcttccccgccaagggcaaactcttcctgcaccgcgtgggccgtgtggc .....
position 1283 (CDS: 29 - 2674)
Synonym: DP97
NM_024072.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens human immunodeficiency virus type I enhancer binding protein 3 (HIVEP3), transcript variant 1, mRNA. (12408 bp)
..... ccaggttagaaatctgcctgggcaagctcttcctgccccagacctacaaagcagc .....
position 10547 (CDS: 1096 - 8316)
Synonym: KBP-1; KBP1; KRC; Schnurri-3; SHN3; ZAS3; ZNF40C
NM_024503.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3 domain and tetratricopeptide repeats 2 (SH3TC2), mRNA. (26588 bp)
..... aaaaaaaaaaaaaaaaccaatgaaatctcttcttggaattatgtatacacaccca .....
position 16134 (CDS: 153 - 4019)
Synonym: CMT4C; MNMN
NM_024577.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 20 (ADAMTS20), mRNA. (5733 bp)
..... attcctagatactggttacggggaatgtcttcttgacaaaccagatgaagaaata .....
position 1379 (CDS: 1 - 5733)
Synonym: ADAM-TS20; ADAMTS-20; GON-1
NM_025003.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NYN domain and retroviral integrase containing (NYNRIN), mRNA. (7857 bp)
..... tgctgcctttcacctttgcggggaatctcttcatggtgcctgatgaccccctggg .....
position 3085 (CDS: 319 - 6015)
Synonym: CGIN1; KIAA1305
NM_025081.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 1, mRNA. (2660 bp)
..... tgggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 799 (CDS: 10 - 2136)
Synonym: RABIP4; ZFYVE12
NM_025158.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin 11 X-linked (PCDH11X), transcript variant c, mRNA. (9190 bp)
..... tttagaatattaaatgactgggcaccctcttcttggtttttaccagagaggcttt .....
position 7421 (CDS: 846 - 4889)
Synonym: PCDH-X; PCDH11; PCDHX
NM_032968.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin 11 X-linked (PCDH11X), transcript variant d, mRNA. (9160 bp)
..... tttagaatattaaatgactgggcaccctcttcttggtttttaccagagaggcttt .....
position 7391 (CDS: 846 - 4859)
Synonym: PCDH-X; PCDH11; PCDHX
NM_032969.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protocadherin 11 Y-linked (PCDH11Y), transcript variant c, mRNA. (9043 bp)
..... tttagaatattaaatgactgggcaccctcttcttggtttttaccagagaggcttt .....
position 7288 (CDS: 735 - 4757)
Synonym: PCDH-PC; PCDH22; PCDHY
NM_032973.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cortactin binding protein 2 (CTTNBP2), mRNA. (5980 bp)
..... gctctgacaaatcatttccaggcaatctcttctgatggatggtggagtctggaag .....
position 3158 (CDS: 93 - 5084)
Synonym: C7orf8; CORTBP2; Orf4
NM_033427.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ANKH inorganic pyrophosphate transport regulator (ANKH), mRNA. (8224 bp)
..... cgttgtgtcctcctcccctggacaatctcctcttggaaccaaaggactgcagctg .....
position 2120 (CDS: 332 - 1810)
Synonym: ANK; CCAL2; CMDJ; CPPDD; HANK; MANK
NM_054027.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 2, mRNA. (2245 bp)
..... aggccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgccctt .....
position 826 (CDS: 379 - 1665)
Synonym: CP26; CYP26; P450RAI; P450RAI1
NM_057157.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin XVIIIA (MYO18A), transcript variant 1, mRNA. (7591 bp)
..... tccctctcgtgtggggtgggggctctctcttcttggtgcctgctgtctttctact .....
position 6763 (CDS: 159 - 6323)
Synonym: MYSPDZ; SPR210
NM_078471.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 2, mRNA. (4933 bp)
..... ccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4224 (CDS: 107 - 949)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_080838.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine-rich pentatricopeptide repeat containing (LRPPRC), mRNA. (6637 bp)
..... cagcagctaagaaaattgagggaaaactcttcttgaaataaccaggcgatacttt .....
position 4228 (CDS: 59 - 4243)
Synonym: CLONE-23970; GP130; LRP130; LSFC
NM_133259.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SPOC domain containing 1 (SPOCD1), mRNA. (3888 bp)
..... aggggcagtatagctccaaggggaatctctgcttggcagaggccccccagaggca .....
position 3301 (CDS: 59 - 3709)
NM_144569.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chromosome 7 open reading frame 33 (C7orf33), mRNA. (1374 bp)
..... ctctaaatttgtgtagattgtgaaatctcttcttgcaagaaaaaagagaaatagc .....
position 943 (CDS: 362 - 895)
NM_145304.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 210, member A (FAM210A), transcript variant 2, mRNA. (4252 bp)
..... ttaaatgaatatgctgtgattggaatctcttcttgggggccggggagagtgctga .....
position 2903 (CDS: 293 - 1111)
Synonym: C18orf19; HsT2329
NM_152352.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens abhydrolase domain containing 2 (ABHD2), transcript variant 2, mRNA. (8761 bp)
..... gaagatcatcctctcgcacaggcaagctctttttggagaccatgttaagaaaccc .....
position 1335 (CDS: 521 - 1798)
Synonym: HS1-2; LABH2; PHPS1-2
NM_152924.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens G protein-coupled receptor 26 (GPR26), mRNA. (10316 bp)
..... gagagccacccctgctttctggccatctcttctttgtctaccatttcaaattgac .....
position 2374 (CDS: 54 - 1067)
NM_153442.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PAS domain containing 1 (PASD1), mRNA. (3250 bp)
..... atagatacctcaaactctgaggcaatttcttcttccagcattcctcagtttccca .....
position 2318 (CDS: 333 - 2654)
Synonym: CT63; OXTES1
NM_173493.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 2C (LCE2C), mRNA. (594 bp)
..... tgcccagctccatgtttccctgcagtctcttcttgctgtggtcccagctctggga .....
position 161 (CDS: 36 - 368)
Synonym: LEP11
NM_178429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger, DHHC-type containing 21 (ZDHHC21), mRNA. (9171 bp)
..... aaaaaactggcaccttttctggaaatctcttattgcaaagaaaagatactgagtg .....
position 6429 (CDS: 479 - 1276)
Synonym: 9130404H11Rik; DHHC-21; DHHC21; DNZ1; HSPC097
NM_178566.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens anoctamin 4 (ANO4), mRNA. (4142 bp)
..... agaaggtcaataaaaatggaggcaagctcttctggaatcactaatggaaaaacca .....
position 578 (CDS: 573 - 3335)
Synonym: TMEM16D
NM_178826.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myotubularin related protein 11 (MTMR11), transcript variant 2, mRNA. (2368 bp)
..... cgggacagtccttccctgctggcagtctcttctcgttggctccctcgacctgcta .....
position 1748 (CDS: 210 - 2132)
Synonym: CRA; RP11-212K13.1
NM_181873.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens izumo sperm-egg fusion 1 (IZUMO1), mRNA. (1621 bp)
..... tcacagacagtgatgtaaaaggcgatctcttcgtgaaggagctattttggatgtt .....
position 858 (CDS: 549 - 1601)
Synonym: IZUMO
NM_182575.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LON peptidase N-terminal domain and ring finger 2 (LONRF2), mRNA. (13920 bp)
..... agccgtgagctgctgggctgggcaatgtcttctgggatgtgagacgtggggtctc .....
position 8499 (CDS: 641 - 2905)
Synonym: RNF192
NM_198461.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kelch-like family member 5 (KLHL5), transcript variant 2, mRNA. (7545 bp)
..... taaacttttggcttatattaggctacctcttcttgcaccacagttcctggcagac .....
position 1329 (CDS: 284 - 2368)
NM_199039.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin XVIIIA (MYO18A), transcript variant 2, mRNA. (7546 bp)
..... tccctctcgtgtggggtgggggctctctcttcttggtgcctgctgtctttctact .....
position 6718 (CDS: 159 - 6278)
Synonym: MYSPDZ; SPR210
NM_203318.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens long intergenic non-protein coding RNA 346 (LINC00346), non-coding RNA. (6322 bp)
..... ctctgaaaagtgggaatatggggaatctcctcttggtttctggttgcacatgtga .....
position 2985
Synonym: C13orf29; NCRNA00346
NR_027701.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC100129046 (LOC100129046), non-coding RNA. (1562 bp)
..... cccagctgattatatcagccggcaaactcctcttgtgacctaggctagtatgagt .....
position 900
NR_034091.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 5, non-coding RNA. (4653 bp)
..... ccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 3944
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NR_037944.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens long intergenic non-protein coding RNA 974 (LINC00974), non-coding RNA. (2141 bp)
..... cccacgagcaggaaagctctggaaatgtcttcttggaaagcaagcagctacccat .....
position 842
NR_038442.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC101060565 (LOC101060565), mRNA. (885 bp)
..... gcagctctggtgaccctcagggaaatctctgcttgttatgaggttggtgggccat .....
position 96 (CDS: 1 - 675)
XM_003960533.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100507319 (LOC100507319), misc_RNA. (2155 bp)
..... acatagtgcttttgacctgtggaaatctcatcttggtaccatggtgctgcacaga .....
position 1048
XR_108980.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100507092 (LOC100507092), misc_RNA. (661 bp)
..... tcatccttgattccccttcaggcaaacacttcttgtgattcatcactgtgtcctc .....
position 612
XR_109285.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2261 bp)
..... acaaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2014
XR_109667.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2260 bp)
..... acaaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2013
XR_112184.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100507319 (LOC100507319), misc_RNA. (2155 bp)
..... acatagtgcttttgacctgtggaaatctcatcttggtaccatggtgctgcacaga .....
position 1048
XR_113239.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens putative transcript Y 11 protein-like (LOC100652931), miscRNA. (663 bp)
..... ggaggtcctacacgtagacggccaatctcttcctggagaaatgaccacatgtctc .....
position 120
XR_132690.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens RNA-binding motif protein, Y chromosome, family 1 member F/J-like (LOC100996822), misc_RNA. (1149 bp)
..... ggaggtcctccatgcagagagccaatctcttcctggagaaatgaccgtatgtcac .....
position 594
XR_159531.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100507319 (LOC100507319), misc_RNA. (2155 bp)
..... acatagtgcttttgacctgtggaaatctcatcttggtaccatggtgctgcacaga .....
position 1048
XR_171798.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2265 bp)
..... acaaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2014
XR_172343.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.038 | 0.038 | q_start
0.258 | 0.220 | q_end
3.346 | 3.088 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.