GGRNA Home | Help | Advanced search

2018-12-12 08:34:03, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
comp1:caagaagagattg99 NM_000132, NM_000138, NM_000783, NM_000892, NM_001002265, NM_001002266, NM_001007098, NM_001008226, NM_001040451, NM_001040452, NM_001042604, NM_001080415, NM_001083617, NM_001098801, NM_001099678, [...]
[AND] 99 NM_000132, NM_000138, NM_000783, NM_000892, NM_001002265, NM_001002266, NM_001007098, NM_001008226, NM_001040451, NM_001040452, NM_001042604, NM_001080415, NM_001083617, NM_001098801, NM_001099678, [...]


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens coagulation factor VIII, procoagulant component (F8), transcript variant 1, mRNA. (9048 bp)
..... aaagctttgaaataaaataacaatgtcttcttgaaatttgtgatggccaagaa .....
position 8058 (CDS: 172 - 7227)
Synonym: AHF; DXS1253E; F8B; F8C; FVIII; HEMA
NM_000132.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fibrillin 1 (FBN1), mRNA. (11695 bp)
..... tcataaatgtcacaataaaacaatctcttcttttttttagtttaccccttggc .....
position 9905 (CDS: 396 - 9011)
NM_000138.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 1, mRNA. (2119 bp)
..... gccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgccctt .....
position 702 (CDS: 46 - 1539)
Synonym: CP26; CYP26; P450RAI; P450RAI1
NM_000783.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kallikrein B, plasma (Fletcher factor) 1 (KLKB1), mRNA. (2252 bp)
..... cacacgcattgttggaggaacaaactcttcttggggagagtggccctggcagg .....
position 1255 (CDS: 72 - 1988)
Synonym: KLK3; PPK
NM_000892.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), transcript variant 1, mRNA. (2604 bp)
..... tggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagaca .....
position 1661 (CDS: 844 - 1719)
Synonym: c-MIR; MARCH-VIII; MIR; RNF178
NM_001002265.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), transcript variant 3, mRNA. (2000 bp)
..... tggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagaca .....
position 1057 (CDS: 240 - 1115)
Synonym: c-MIR; MARCH-VIII; MIR; RNF178
NM_001002266.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 2, mRNA. (2150 bp)
..... atactgttctctcatggctccaagctcttcttgtcctgctgtatccaaaatat .....
position 1445 (CDS: 169 - 1137)
NM_001007098.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 154, member B (FAM154B), mRNA. (3146 bp)
..... gatttttttttaaaattgctcaatctctttttgtacttgttttctccttttca .....
position 2364 (CDS: 70 - 1266)
NM_001008226.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 2, mRNA. (2674 bp)
..... ggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 815 (CDS: 348 - 2150)
Synonym: RABIP4; ZFYVE12
NM_001040451.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 3, mRNA. (2485 bp)
..... ggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 626 (CDS: 159 - 1961)
Synonym: RABIP4; ZFYVE12
NM_001040452.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-3' exoribonuclease 1 (XRN1), transcript variant 2, mRNA. (10053 bp)
..... atctcaccataagtcaacaccaatctcttcttcaagaagaaaatcaagaaaac .....
position 5079 (CDS: 68 - 5149)
Synonym: SEP1
NM_001042604.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens U2 snRNP-associated SURP domain containing (U2SURP), mRNA. (7464 bp)
..... agtcttccaatgaaagaccaccatctcttcttgtgatagaaaccaaaaaacct .....
position 637 (CDS: 100 - 3189)
Synonym: fSAPa; SR140
NM_001080415.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RB1-inducible coiled-coil 1 (RB1CC1), transcript variant 2, mRNA. (6661 bp)
..... cccagcagaaggagaccttgaaatctcttcttgaacaagagacagaaaatttg .....
position 3826 (CDS: 559 - 5334)
Synonym: CC1; FIP200
NM_001083617.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 210, member A (FAM210A), transcript variant 1, mRNA. (4392 bp)
..... aaatgaatatgctgtgattggaatctcttcttgggggccggggagagtgctga .....
position 3045 (CDS: 433 - 1251)
Synonym: C18orf19; HsT2329
NM_001098801.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine rich repeat containing 58 (LRRC58), mRNA. (7683 bp)
..... aaatatctcccattctttttctatctcttcttggtctatatttactaagaatt .....
position 6777 (CDS: 97 - 1212)
NM_001099678.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Purkinje cell protein 4 like 1 (PCP4L1), mRNA. (1480 bp)
..... tcactagtctaagggtggaacaatttcttcttggtataaggttctttgatcag .....
position 679 (CDS: 249 - 455)
Synonym: IQM1
NM_001102566.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 2, mRNA. (4833 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4747 (CDS: 90 - 1757)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_001114978.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 4, mRNA. (4697 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4611 (CDS: 142 - 1902)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_001114980.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 5, mRNA. (4603 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4517 (CDS: 142 - 1527)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_001114981.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fermitin family member 2 (FERMT2), transcript variant 2, mRNA. (3372 bp)
..... tggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaa .....
position 904 (CDS: 187 - 2250)
Synonym: KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
NM_001134999.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fermitin family member 2 (FERMT2), transcript variant 3, mRNA. (2161 bp)
..... tggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaa .....
position 904 (CDS: 187 - 2088)
Synonym: KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
NM_001135000.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mucin 15, cell surface associated (MUC15), transcript variant 1, mRNA. (3409 bp)
..... tctgcaaaatgggcataatacaatctattcttgccacatcaagggattgttat .....
position 286 (CDS: 274 - 1359)
Synonym: MUC-15; PAS3; PASIII
NM_001135091.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mucin 15, cell surface associated (MUC15), transcript variant 3, mRNA. (3259 bp)
..... tctgcaaaatgggcataatacaatctattcttgccacatcaagggattgttat .....
position 286 (CDS: 274 - 1209)
Synonym: MUC-15; PAS3; PASIII
NM_001135092.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens stonin 1 (STON1), transcript variant 1, mRNA. (5651 bp)
..... ggtgccgtcttcatttcttcccatctcttcttgctgcttagtgtctgtactag .....
position 2783 (CDS: 213 - 2420)
Synonym: SALF; SBLF; STN1; STNB1
NM_001198595.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens torsin A interacting protein 2 (TOR1AIP2), transcript variant 3, mRNA. (8331 bp)
..... aactaatttagactagagccctatctcttcttgagaagctgggatttgaagga .....
position 612 (CDS: 815 - 2227)
Synonym: IFRG15; LULL1; NET9; RP11-12M5.5
NM_001199260.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 3, mRNA. (4739 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4032 (CDS: 107 - 574)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_001204869.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 4, mRNA. (4459 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 3752 (CDS: 107 - 475)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_001204870.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptotagmin XIII (SYT13), transcript variant 2, mRNA. (5388 bp)
..... ataagctgaaagctgaccagcattctcttcttggtaacatctactactccaat .....
position 3938 (CDS: 777 - 1625)
NM_001247987.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ceramide synthase 6 (CERS6), transcript variant 1, mRNA. (6868 bp)
..... tagacacccacaattgtccccaatctcttcatgatgttgcattaatagttgtt .....
position 4869 (CDS: 201 - 1379)
Synonym: CERS5; LASS6
NM_001256126.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 2, mRNA. (5657 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4332 (CDS: 1269 - 3038)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_001256574.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 3, mRNA. (5645 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4320 (CDS: 1257 - 3026)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_001256575.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 4, mRNA. (5384 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4059 (CDS: 1215 - 2765)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_001256576.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized protein ENSP00000383407-like (LOC388813), mRNA. (892 bp)
..... gagagtgaacaaacaccaaacaatctcttcgtgggagtttctaatttagagaa .....
position 94 (CDS: 35 - 433)
NM_001256579.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 (PSMD11), transcript variant 1, mRNA. (4035 bp)
..... ctaaagcagctcgcctggtccgatctcttcttgatctgtttcttgatatggaa .....
position 329 (CDS: 62 - 1330)
Synonym: p44.5; Rpn6; S9
NM_001270482.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC643355 (LOC643355), mRNA. (3036 bp)
..... tggacactaattttatataccaacctcttcttggtaaagagacatagctcatg .....
position 1686 (CDS: 330 - 707)
NM_001270945.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 (PSMD11), transcript variant 2, mRNA. (3914 bp)
..... ctaaagcagctcgcctggtccgatctcttcttgatctgtttcttgatatggaa .....
position 329 (CDS: 62 - 1330)
Synonym: p44.5; Rpn6; S9
NM_002815.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 1, mRNA. (5520 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4195 (CDS: 1132 - 2901)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_003633.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 1, mRNA. (4927 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4841 (CDS: 90 - 2132)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_003722.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1, mRNA. (5194 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4487 (CDS: 107 - 1210)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_003882.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cellular retinoic acid binding protein 1 (CRABP1), mRNA. (782 bp)
..... agaacaagatccactgcacgcaaactcttcttgaaggggacggccccaaaacc .....
position 397 (CDS: 106 - 519)
NM_004378.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 (B4GALT5), mRNA. (4743 bp)
..... aaatagacataaatatataacaatcacttcttgaagaagtataattgtaaata .....
position 1951 (CDS: 195 - 1361)
Synonym: B4Gal-T5; BETA4-GALT-IV; beta4Gal-T5; beta4GalT-V; gt-V
NM_004776.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 (ARHGEF6), mRNA. (5282 bp)
..... aagaatatgctaaagaacttcagtctcttcttgttacttacttaagacccctg .....
position 1243 (CDS: 463 - 2793)
Synonym: alpha-PIX; alphaPIX; Cool-2; COOL2; MRX46; PIXA
NM_004840.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens paired-like homeobox 2a (PHOX2A), mRNA. (1716 bp)
..... cccggccccgccctgaagaccaatctcttctagctgccggcctctggaggctc .....
position 1015 (CDS: 173 - 1027)
NM_005169.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fermitin family member 2 (FERMT2), transcript variant 1, mRNA. (3351 bp)
..... tggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaa .....
position 904 (CDS: 187 - 2229)
Synonym: KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
NM_006832.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens stonin 1 (STON1), transcript variant 2, mRNA. (5534 bp)
..... ggtgccgtcttcatttcttcccatctcttcttgctgcttagtgtctgtactag .....
position 2666 (CDS: 96 - 2303)
Synonym: SALF; SBLF; STN1; STNB1
NM_006873.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proline synthetase co-transcribed homolog (bacterial) (PROSC), mRNA. (2586 bp)
..... aacaaattgatggctgtccccaatctcttcatgctggaaacagtggattctgt .....
position 404 (CDS: 78 - 905)
NM_007198.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB3 GTPase activating protein subunit 2 (non-catalytic) (RAB3GAP2), mRNA. (7329 bp)
..... ttgatggatttagcctttttcaatctcttcgtgcttgtcgaaatcaggtagca .....
position 840 (CDS: 165 - 4346)
Synonym: p150; RAB3-GAP150; RAB3GAP150; RP11-568G11.1; WARBM2
NM_012414.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 2B (LCE2B), mRNA. (619 bp)
..... cccagctccatgttcccctgcagtctcttcttgctgtggtcccatctctgggg .....
position 182 (CDS: 55 - 387)
Synonym: LEP10; SPRL1B; XP5
NM_014357.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RB1-inducible coiled-coil 1 (RB1CC1), transcript variant 1, mRNA. (6670 bp)
..... cccagcagaaggagaccttgaaatctcttcttgaacaagagacagaaaatttg .....
position 3826 (CDS: 559 - 5343)
Synonym: CC1; FIP200
NM_014781.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens pannexin 1 (PANX1), mRNA. (2782 bp)
..... tacaacgatttgagcctctacaatctcttcttggaggaaaatataagtgaggt .....
position 1378 (CDS: 386 - 1666)
Synonym: MRS1; PX1; UNQ2529
NM_015368.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 6-like (ERCC6L), mRNA. (4224 bp)
..... ccacagtatgcatgtgatttcaatcttttcttggaagactcagcagacaacag .....
position 2956 (CDS: 98 - 3850)
Synonym: PICH; RAD26L
NM_017669.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing 4 (ARMC4), mRNA. (3572 bp)
..... acctccttgttggaataaaccaagctcttcttgtgaatgttacaaaagcagtt .....
position 2524 (CDS: 94 - 3228)
Synonym: RP11-691I13.1
NM_018076.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens round spermatid basic protein 1 (RSBN1), mRNA. (6604 bp)
..... taaggtgtgaggtaacaattcaatctcttcttcaaatcaaaatgagaattctc .....
position 2702 (CDS: 37 - 2445)
Synonym: ROSBIN; RP11-324J2.1
NM_018364.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-3' exoribonuclease 1 (XRN1), transcript variant 1, mRNA. (10092 bp)
..... atctcaccataagtcaacaccaatctcttcttcaagaagaaaatcaagaaaac .....
position 5118 (CDS: 68 - 5188)
Synonym: SEP1
NM_019001.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens taste receptor, type 2, member 1 (TAS2R1), mRNA. (1355 bp)
..... attttcttcttgcagtgatacaatttcttcttgggattttcacaaatggcatc .....
position 365 (CDS: 320 - 1219)
Synonym: T2R1; TRB7
NM_019599.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coagulation factor VIII, procoagulant component (F8), transcript variant 2, mRNA. (2617 bp)
..... aaagctttgaaataaaataacaatgtcttcttgaaatttgtgatggccaagaa .....
position 1627 (CDS: 146 - 796)
Synonym: AHF; DXS1253E; F8B; F8C; FVIII; HEMA
NM_019863.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptotagmin XIII (SYT13), transcript variant 1, mRNA. (5184 bp)
..... ataagctgaaagctgaccagcattctcttcttggtaacatctactactccaat .....
position 3720 (CDS: 127 - 1407)
NM_020826.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane BAX inhibitor motif containing 1 (TMBIM1), mRNA. (2375 bp)
..... gcccatgggtctccttgcttcaatcccttcttgtttcagtgacatatgtattg .....
position 1629 (CDS: 133 - 1068)
Synonym: LFG3; MST100; MSTP100; PP1201; RECS1
NM_022152.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens torsin A interacting protein 2 (TOR1AIP2), transcript variant 1, mRNA. (7074 bp)
..... aactaatttagactagagccctatctcttcttgagaagctgggatttgaagga .....
position 612 (CDS: 928 - 1323)
Synonym: IFRG15; LULL1; NET9; RP11-12M5.5
NM_022347.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens N-terminal EF-hand calcium binding protein 1 (NECAB1), mRNA. (5140 bp)
..... cctaaatgacttttgacatacaaactcttcttgagaatgtttgttgtaaatgg .....
position 2959 (CDS: 195 - 1250)
Synonym: EFCBP1; STIP-1
NM_022351.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3 domain and tetratricopeptide repeats 2 (SH3TC2), mRNA. (26588 bp)
..... aaaaaaaaaaaaaaccaatgaaatctcttcttggaattatgtatacacaccca .....
position 16136 (CDS: 153 - 4019)
Synonym: CMT4C; MNMN
NM_024577.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATPase, class V, type 10B (ATP10B), mRNA. (7582 bp)
..... tactggcagatgatattcttcaatctcttctttacctccttgcctcctcttgt .....
position 4297 (CDS: 848 - 5233)
Synonym: ATPVB
NM_025153.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 1, mRNA. (2660 bp)
..... ggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 801 (CDS: 10 - 2136)
Synonym: RABIP4; ZFYVE12
NM_025158.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 3 (CCDC3), mRNA. (2753 bp)
..... agggctcattccagccattccaatctcttcttctttatgcaaacacttttccc .....
position 1907 (CDS: 135 - 947)
Synonym: RP11-347I22.1
NM_031455.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FLYWCH-type zinc finger 1 (FLYWCH1), transcript variant 1, mRNA. (5009 bp)
..... taggccaggtcaacccacaccaatctcttctggacaggtgctgggtaggcctt .....
position 2995 (CDS: 364 - 2511)
NM_032296.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ANKH inorganic pyrophosphate transport regulator (ANKH), mRNA. (8224 bp)
..... ttgtgtcctcctcccctggacaatctcctcttggaaccaaaggactgcagctg .....
position 2122 (CDS: 332 - 1810)
NM_054027.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 2, mRNA. (2245 bp)
..... gccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgccctt .....
position 828 (CDS: 379 - 1665)
Synonym: CP26; CYP26; P450RAI; P450RAI1
NM_057157.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 2, mRNA. (4933 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4226 (CDS: 107 - 949)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_080838.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polycystic kidney and hepatic disease 1 (autosomal recessive) (PKHD1), transcript variant 1, mRNA. (16235 bp)
..... ttttcctgtgttagttcaaagaatctcttcttgcctcccattgctgattttct .....
position 15267 (CDS: 277 - 12501)
NM_138694.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), transcript variant 2, mRNA. (2511 bp)
..... tggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagaca .....
position 1568 (CDS: 751 - 1626)
Synonym: c-MIR; MARCH-VIII; MIR; RNF178
NM_145021.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chromosome 7 open reading frame 33 (C7orf33), mRNA. (1374 bp)
..... ctaaatttgtgtagattgtgaaatctcttcttgcaagaaaaaagagaaatagc .....
position 945 (CDS: 362 - 895)
NM_145304.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 210, member A (FAM210A), transcript variant 2, mRNA. (4252 bp)
..... aaatgaatatgctgtgattggaatctcttcttgggggccggggagagtgctga .....
position 2905 (CDS: 293 - 1111)
Synonym: C18orf19; HsT2329
NM_152352.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cardiomyopathy associated 5 (CMYA5), mRNA. (12911 bp)
..... acacatccgatgtgcctaaacaatctgttcttgtttcaaagcaccacttggag .....
position 8662 (CDS: 73 - 12282)
Synonym: C5orf10; SPRYD2; TRIM76
NM_153610.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 4A (LCE4A), mRNA. (388 bp)
..... tgcatcctcatgcccacctccaatctcttcctgctgtggctccagctctgggg .....
position 136 (CDS: 30 - 329)
Synonym: LEP8; SPRL4A
NM_178356.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 2C (LCE2C), mRNA. (594 bp)
..... cccagctccatgtttccctgcagtctcttcttgctgtggtcccagctctggga .....
position 163 (CDS: 36 - 368)
Synonym: LEP11
NM_178429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ceramide synthase 6 (CERS6), transcript variant 2, mRNA. (6844 bp)
..... tagacacccacaattgtccccaatctcttcatgatgttgcattaatagttgtt .....
position 4845 (CDS: 201 - 1355)
Synonym: CERS5; LASS6
NM_203463.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens methyltransferase like 10 (METTL10), mRNA. (2638 bp)
..... attaagtaattgagtcctttcaatgtcttcttgaggtatgtattgcttgttct .....
position 1702 (CDS: 38 - 913)
Synonym: C10orf138; Em:AC068896.3
NM_212554.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HOXA11 antisense RNA (HOXA11-AS), antisense RNA. (1628 bp)
..... gagaagggagggagccggctcagtctcttcttgtttttccaaacttcaaggtc .....
position 1211
Synonym: HOXA-AS5; HOXA11-AS1; HOXA11AS; HOXA11S; NCRNA00076
NR_002795.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ankyrin repeat domain 57 pseudogene (LOC389834), non-coding RNA. (8205 bp)
..... gctaaatcttctcaattttccaatcttttcttgaatctattagatacctatag .....
position 4180
NR_027420.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens OTX2 antisense RNA 1 (head to head) (OTX2-AS1), non-coding RNA. (2440 bp)
..... agaacatgctctttatcttccagtctcttcttgtcaatttggaaattgcagac .....
position 243
Synonym: OTX2OS1
NR_029385.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens STXBP5 antisense RNA 1 (STXBP5-AS1), non-coding RNA. (3082 bp)
..... taatggcagcgtccccacctaaatctcttcttgaattgtagttcccataatcc .....
position 1427
NR_034115.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 5, non-coding RNA. (4653 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 3946
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NR_037944.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant G, non-coding RNA. (3218 bp)
..... gcttttctaagttactctttcaagctcttcttgcgatagaaatgaaatgaaca .....
position 288
Synonym: DFNB10; DFNB8; ECHOS1; TADG12
NR_046020.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized protein MGC27345 (MGC27345), non-coding RNA. (10079 bp)
..... tcctcctgggaactgcataacaaactcttcttgcagagatagttttctctgtg .....
position 8660
NR_046216.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 5, non-coding RNA. (3705 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 2380
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NR_046318.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC101059976 (LOC101059976), mRNA. (2424 bp)
..... gagccgagctcacgcgcccccaatcgcttcttgcccgcggactcgggcccaac .....
position 388 (CDS: 1 - 1149)
XM_003959913.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC101059976 (LOC101059976), mRNA. (2424 bp)
..... gagccgagctcacgcgcccccaatcgcttcttgcccgcggactcgggcccaac .....
position 388 (CDS: 1 - 1149)
XM_003960274.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens late cornified envelope 4A (LCE4A), mRNA. (684 bp)
..... tgcatcctcatgcccacctccaatctcttcctgctgtggctccagctctgggg .....
position 357 (CDS: 41 - 568)
XM_003960896.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128909 (LOC100128909), misc_RNA. (677 bp)
..... atattcaagcaagttcaatccaatctcttcctgactcactgtctcatcaacat .....
position 385
XR_108975.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2261 bp)
..... aaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2016
XR_109667.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506157 (LOC100506157), misc_RNA. (580 bp)
..... atctcttttgcattgttttccaatctgttcttggttgccattgtatagaaaca .....
position 400
XR_110279.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2260 bp)
..... aaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2015
XR_112184.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128909 (LOC100128909), misc_RNA. (677 bp)
..... atattcaagcaagttcaatccaatctcttcctgactcactgtctcatcaacat .....
position 385
XR_113235.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens putative transcript Y 11 protein-like (LOC100652931), miscRNA. (663 bp)
..... aggtcctacacgtagacggccaatctcttcctggagaaatgaccacatgtctc .....
position 122
XR_132690.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506157 (LOC100506157), misc_RNA. (580 bp)
..... atctcttttgcattgttttccaatctgttcttggttgccattgtatagaaaca .....
position 400
XR_133038.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens RNA-binding motif protein, Y chromosome, family 1 member F/J-like (LOC100996822), misc_RNA. (1149 bp)
..... aggtcctccatgcagagagccaatctcttcctggagaaatgaccgtatgtcac .....
position 596
XR_159531.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128909 (LOC100128909), misc_RNA. (677 bp)
..... atattcaagcaagttcaatccaatctcttcctgactcactgtctcatcaacat .....
position 385
XR_171795.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506157 (LOC100506157), misc_RNA. (580 bp)
..... atctcttttgcattgttttccaatctgttcttggttgccattgtatagaaaca .....
position 400
XR_172037.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2265 bp)
..... aaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2016
XR_172343.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.035 | 0.035 | q_start
0.199 | 0.164 | q_end
1.386 | 1.187 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.