GGRNA Home | Help | Advanced search

2021-10-29 02:00:08, GGRNA : RefSeq release 60 (20130726)


search term:hits:results:
comp:caagaagagattg1 NM_015368
[AND] 1 NM_015368


Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens pannexin 1 (PANX1), mRNA. (2782 bp)
..... tacaacgatttgagcctctacaatctcttcttggaggaaaatataagtgaggt .....
position 1378 (CDS: 386 - 1666)
Synonym: MRS1; PX1; UNQ2529
NM_015368.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.012 | 0.012 | q_start
0.086 | 0.074 | q_end
0.087 | 0.001 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.