GGRNA | Results

2021-04-23 22:40:36, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:	hits:	results:
comp:caagaagagattg	1	NM_015368
[AND]	1	NM_015368

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens pannexin 1 (PANX1), mRNA. (2782 bp)

..... tacaacgatttgagcctctacaatctcttcttggaggaaaatataagtgaggt .....

position 1378 (CDS: 386 - 1666)

Synonym: MRS1; PX1; UNQ2529
NM_015368.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

[GGRNA | 2021-04-23 22:40:36 | RefSeq release 60 (20130726)]
RefSeq ID	Version	Symbol	GeneID	Definition
NM_015368	NM_015368.3	PANX1	24145	Homo sapiens pannexin 1 (PANX1), mRNA.	position 1378 (CDS: 386 - 1666)

Debug Info:

0.133 | 0.133 | q_start
0.223 | 0.090 | q_end
0.261 | 0.038 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.