GGRNA | Results

2023-11-29 15:16:59, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:	hits:	results:
seq:caagaagagattg	12	NM_001008224, NM_001197294, NM_001387, NM_001870, NM_003380, NM_004755, NM_015457, NM_018003, NM_024940, NM_181453, NM_182398, NR_028063
[AND]	12	NM_001008224, NM_001197294, NM_001387, NM_001870, NM_003380, NM_004755, NM_015457, NM_018003, NM_024940, NM_181453, NM_182398, NR_028063

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 2, mRNA. (7096 bp)

..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaatt .....

position 3196 (CDS: 367 - 4578)

Synonym: NUCLING
NM_001008224.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 1, mRNA. (5496 bp)

..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtac .....

position 2284 (CDS: 199 - 2253)

Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001197294.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 2, mRNA. (5066 bp)

..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtac .....

position 1854 (CDS: 111 - 1823)

Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001387.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens carboxypeptidase A3 (mast cell) (CPA3), mRNA. (1699 bp)

..... aaatcttgattcatgatctacaagaagagattgagaaacagtttgatgttaaa .....

position 341 (CDS: 53 - 1306)

Synonym: MC-CPA
NM_001870.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens vimentin (VIM), mRNA. (2151 bp)

..... aacgcaaagtggaatctttgcaagaagagattgcctttttgaagaaactccac .....

position 1095 (CDS: 414 - 1814)

NM_003380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA. (3883 bp)

..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgc .....

position 1109 (CDS: 216 - 2624)

Synonym: MSK1; MSPK1; RLPK
NM_004755.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5), mRNA. (4582 bp)

..... cttaaagggcttgggaataacaagaagagattgaagacagagaagcttgccct .....

position 451 (CDS: 1257 - 3404)

Synonym: DHHC5; ZNF375
NM_015457.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA. (6873 bp)

..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaatt .....

position 2973 (CDS: 105 - 4355)

Synonym: NUCLING
NM_018003.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA. (7555 bp)

..... tcacagcctctgattttttccaagaagagattgccttcaccattgttaaatgt .....

position 5996 (CDS: 138 - 5750)

NM_024940.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1, mRNA. (6998 bp)

..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggcttt .....

position 704 (CDS: 155 - 5209)

Synonym: GCC185; RANBP2L4; REN53
NM_181453.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 2, mRNA. (2343 bp)

..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgc .....

position 1109 (CDS: 216 - 1865)

Synonym: MSK1; MSPK1; RLPK
NM_182398.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 2, non-coding RNA. (6913 bp)

..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggcttt .....

position 619

Synonym: GCC185; RANBP2L4; REN53
NR_028063.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

[GGRNA | 2023-11-29 15:16:59 | RefSeq release 60 (20130726)]
RefSeq ID	Version	Symbol	GeneID	Definition
NM_001008224	NM_001008224.1	UACA	55075	Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 2, mRNA.	position 3196 (CDS: 367 - 4578) 
NM_001197294	NM_001197294.1	DPYSL3	1809	Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 1, mRNA.	position 2284 (CDS: 199 - 2253) 
NM_001387	NM_001387.2	DPYSL3	1809	Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 2, mRNA.	position 1854 (CDS: 111 - 1823) 
NM_001870	NM_001870.2	CPA3	1359	Homo sapiens carboxypeptidase A3 (mast cell) (CPA3), mRNA.	position 341 (CDS: 53 - 1306) 
NM_003380	NM_003380.3	VIM	7431	Homo sapiens vimentin (VIM), mRNA.	position 1095 (CDS: 414 - 1814) 
NM_004755	NM_004755.2	RPS6KA5	9252	Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA.	position 1109 (CDS: 216 - 2624) 
NM_015457	NM_015457.2	ZDHHC5	25921	Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5), mRNA.	position 451 (CDS: 1257 - 3404) 
NM_018003	NM_018003.2	UACA	55075	Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA.	position 2973 (CDS: 105 - 4355) 
NM_024940	NM_024940.6	DOCK5	80005	Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA.	position 5996 (CDS: 138 - 5750) 
NM_181453	NM_181453.3	GCC2	9648	Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1, mRNA.	position 704 (CDS: 155 - 5209) 
NM_182398	NM_182398.1	RPS6KA5	9252	Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 2, mRNA.	position 1109 (CDS: 216 - 1865) 
NR_028063	NR_028063.1	GCC2	9648	Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 2, non-coding RNA.	position 619

Debug Info:

0.012 | 0.012 | q_start
0.084 | 0.072 | q_end
0.094 | 0.010 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.