GGRNA Home | Help | Advanced search

2018-08-18 22:52:42, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:hits:results:
both1:caagaagagattg413 NM_000109, NM_000246, NM_000450, NM_000769, NM_000770, NM_000771, NM_000772, NM_000845, NM_000927, NM_001001971, NM_001008224, NM_001011513, NM_001011515, NM_001011516, NM_001012991, [...]
[AND] 413 NM_000109, NM_000246, NM_000450, NM_000769, NM_000770, NM_000771, NM_000772, NM_000845, NM_000927, NM_001001971, NM_001008224, NM_001011513, NM_001011515, NM_001011516, NM_001012991, [...]

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens dystrophin (DMD), transcript variant Dp427c, mRNA. (14069 bp)
..... ttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctg .....
position 5172 (CDS: 345 - 11378)
Synonym: BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272
NM_000109.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens class II, major histocompatibility complex, transactivator (CIITA), mRNA. (4654 bp)
..... accagatggacctggctggagaagaagagattgagctctactcagaacccgac .....
position 308 (CDS: 134 - 3526)
Synonym: C2TA; CIITAIV; MHC2TA; NLRA
NM_000246.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens selectin E (SELE), mRNA. (3875 bp)
..... acctggttgcaattcaaaacaaagaagagattgagtacctaaactccatattg .....
position 314 (CDS: 158 - 1990)
Synonym: CD62E; ELAM; ELAM1; ESEL; LECAM2
NM_000450.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 19 (CYP2C19), mRNA. (1473 bp)
..... cagaggtcacagctaaagtccaggaagagattgaacgtgtcattggcagaaac .....
position 970 (CDS: 1 - 1473)
Synonym: CPCJ; CYP2C; P450C2C; P450IIC19
NM_000769.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 1, mRNA. (1924 bp)
..... cagaggtcacagctaaagtccaggaagagattgatcatgtaattggcagacac .....
position 1065 (CDS: 96 - 1568)
Synonym: CPC8; CYPIIC8; MP-12/MP-20
NM_000770.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 9 (CYP2C9), mRNA. (1876 bp)
..... cagaggtcacagctaaagtccaggaagagattgaacgtgtgattggcagaaac .....
position 995 (CDS: 26 - 1498)
Synonym: CPC9; CYP2C; CYP2C10; CYPIIC9; P450IIC9
NM_000771.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 18 (CYP2C18), transcript variant 1, mRNA. (2562 bp)
..... cagaggtcacagctaaagtccaggaagagattgaatgtgtagttggcagaaac .....
position 1296 (CDS: 327 - 1799)
Synonym: CPCI; CYP2C; CYP2C17; P450-6B/29C; P450IIC17
NM_000772.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 1, mRNA. (3572 bp)
..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatt .....
position 1272 (CDS: 312 - 3038)
Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NM_000845.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1 (ABCB1), mRNA. (4718 bp)
..... acaacagccgggtggtgtcacaggaagagattgtgagggcagcaaaggaggcc .....
position 3917 (CDS: 494 - 4336)
Synonym: ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1
NM_000927.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 2, mRNA. (3101 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatt .....
position 1412 (CDS: 135 - 1598)
Synonym: FAM13C1
NM_001001971.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 2, mRNA. (7096 bp)
..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaatt .....
position 3196 (CDS: 367 - 4578)
Synonym: NUCLING
NM_001008224.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 2, mRNA. (5805 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 634 (CDS: 182 - 1645)
Synonym: ENH; ENH1; L9; LIM
NM_001011513.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 4, mRNA. (2031 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 652 (CDS: 182 - 886)
Synonym: ENH; ENH1; L9; LIM
NM_001011515.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 5, mRNA. (1971 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 592 (CDS: 182 - 826)
Synonym: ENH; ENH1; L9; LIM
NM_001011516.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lysine-rich nucleolar protein 1 (KNOP1), mRNA. (1974 bp)
..... aggtgaggcgaaaggccttgcaagaagagatcgatcgcgagtcaggcaaaacg .....
position 1021 (CDS: 16 - 1392)
Synonym: 101F10.1; C16orf88; FAM191A; TSG118
NM_001012991.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Rho GTPase activating protein 5 (ARHGAP5), transcript variant 1, mRNA. (9604 bp)
..... ttaacactcttttgccaaatctagaagagattgaacatttgaattggtcagaa .....
position 1372 (CDS: 316 - 4824)
Synonym: GFI2; p190-B; p190BRhoGAP; RhoGAP5
NM_001030055.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens microtubule associated tumor suppressor candidate 2 (MTUS2), transcript variant 1, mRNA. (6957 bp)
..... gttgagaaggaaacccaggagaagaagagattgagccgaaccaatgaagagct .....
position 4042 (CDS: 59 - 4198)
Synonym: CAZIP; ICIS; KIAA0774; TIP150
NM_001033602.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NOP2 nucleolar protein (NOP2), transcript variant 2, mRNA. (2772 bp)
..... cgtgctcgaaagagggcagccaagaggagattgggctctgttgaagcccctaa .....
position 354 (CDS: 199 - 2625)
Synonym: NOL1; NOP120; NSUN1; p120
NM_001033714.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eukaryotic translation initiation factor 3, subunit B (EIF3B), transcript variant 2, mRNA. (3084 bp)
..... ccttctatgggtcttttggacaagaagagtttgaagatctctgggataaaaga .....
position 1457 (CDS: 84 - 2528)
Synonym: EIF3-ETA; EIF3-P110; EIF3-P116; EIF3S9; PRT1
NM_001037283.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 2, mRNA. (3532 bp)
..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgca .....
position 1319 (CDS: 170 - 3379)
Synonym: FAM42A; HsT19294; RIA1
NM_001040610.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 1, mRNA. (7653 bp)
..... gtaagataatagacagccaacaagatgagattgacagaatgattttagaaatt .....
position 2467 (CDS: 589 - 3006)
Synonym: bA57K17.2; C6orf204; NY-BR-15; RP11-57K17.2
NM_001042475.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lysine (K)-specific demethylase 5A (KDM5A), mRNA. (10835 bp)
..... cagttttcaaagaacgggagcaaaaagagattgaagccatgcattctctcaga .....
position 3766 (CDS: 364 - 5436)
Synonym: JARID1A; RBBP-2; RBBP2; RBP2
NM_001042603.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 2, mRNA. (3380 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttg .....
position 1137 (CDS: 183 - 2426)
Synonym: CALCOCO3; T6BP; TXBP151
NM_001079864.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane channel-like 3 (TMC3), mRNA. (3303 bp)
..... tgaagaagaggaggagacgccaagcagagattggatcaaacggtctcttcccc .....
position 2846 (CDS: 1 - 3303)
NM_001080532.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cubilin (intrinsic factor-cobalamin receptor) (CUBN), mRNA. (11933 bp)
..... gtatcctggaaactatcccccaggaagagattgtgtctggattgttgtaacta .....
position 1887 (CDS: 53 - 10924)
Synonym: gp280; IFCR; MGA1
NM_001081.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein prenyltransferase alpha subunit repeat containing 1 (PTAR1), mRNA. (10057 bp)
..... aaagggcacagcgactcatacaagaagagatggaggtctgtggtgaagcagca .....
position 554 (CDS: 23 - 1231)
NM_001099666.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, beta (ACTB), mRNA. (1852 bp)
..... aacctaacttgcgcagaaaacaagatgagattggcatggctttatttgttttt .....
position 1273 (CDS: 85 - 1212)
Synonym: BRWS1; PS1TP5BP1
NM_001101.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 2, mRNA. (2209 bp)
..... atattttggatacagcaggacaagaagagtttggagccatgagagaacagtat .....
position 377 (CDS: 395 - 778)
Synonym: TC21
NM_001102669.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 1, mRNA. (7376 bp)
..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttg .....
position 4938 (CDS: 399 - 5870)
Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_001105206.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 3, mRNA. (7372 bp)
..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttg .....
position 4934 (CDS: 416 - 5866)
Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_001105207.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 178 (CCDC178), transcript variant 1, mRNA. (3398 bp)
..... gattgaaggctcagcaaattaaagaagagattgataaggatatttaccaggat .....
position 1109 (CDS: 143 - 2746)
Synonym: C18orf34
NM_001105528.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens suppressor of Ty 5 homolog (S. cerevisiae) (SUPT5H), transcript variant 2, mRNA. (3734 bp)
..... gagcagaggacattctagagaaagaagagattgaagcctccaatatcgataat .....
position 483 (CDS: 180 - 3443)
Synonym: SPT5; SPT5H; Tat-CT1
NM_001111020.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens bromodomain containing 2 (BRD2), transcript variant 2, mRNA. (4807 bp)
..... cctctttacgtgattcaaacccagaagagattgagattgattttgaaacactc .....
position 3655 (CDS: 1615 - 4020)
Synonym: D6S113E; FSH; FSRG1; NAT; RING3; RNF3
NM_001113182.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SET nuclear oncogene (SET), transcript variant 1, mRNA. (2863 bp)
..... agaagggagaaaaagaacagcaagaagcgattgaacacattgatgaagtacaa .....
position 365 (CDS: 242 - 1114)
Synonym: 2PP2A; I2PP2A; IGAAD; IPP2A2; PHAPII; TAF-I; TAF-IBETA
NM_001122821.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 2, mRNA. (3873 bp)
..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatt .....
position 1518 (CDS: 558 - 3284)
Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NM_001127323.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leukemia inhibitory factor receptor alpha (LIFR), transcript variant 1, mRNA. (10258 bp)
..... cctgagataatgagaaaaggccagaagagattgtttgatctctgtctgtcaat .....
position 5676 (CDS: 333 - 3626)
Synonym: CD118; LIF-R; SJS2; STWS; SWS
NM_001127671.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 18 (CYP2C18), transcript variant 2, mRNA. (2385 bp)
..... cagaggtcacagctaaagtccaggaagagattgaatgtgtagttggcagaaac .....
position 1119 (CDS: 327 - 1622)
Synonym: CPCI; CYP2C; CYP2C17; P450-6B/29C; P450IIC17
NM_001128925.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens suppressor of Ty 5 homolog (S. cerevisiae) (SUPT5H), transcript variant 3, mRNA. (3659 bp)
..... gagcagaggacattctagagaaagaagagattgaagcctccaatatcgataat .....
position 408 (CDS: 105 - 3368)
Synonym: SPT5; SPT5H; Tat-CT1
NM_001130824.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cysteine-rich secretory protein 1 (CRISP1), transcript variant 1, mRNA. (1892 bp)
..... tcaccgacttgccaaatgtacaagaagagatcgttaatatacacaacgccctc .....
position 200 (CDS: 80 - 829)
Synonym: AEGL1; ARP; CRISP-1; HSCRISP1D; HSCRISP1G; HUMARP
NM_001131.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ring finger protein 212 (RNF212), transcript variant 1, mRNA. (2420 bp)
..... ttagaatttcaagaaaaacacaggaagagattgttagccttctatagagaaaa .....
position 370 (CDS: 101 - 994)
Synonym: ZHP3
NM_001131034.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 52kDa, polypeptide 1 (RPS6KC1), transcript variant 2, mRNA. (4170 bp)
..... cattatgcaatgaatatgggcaagaaaagattgaaccagggtctttgaatgag .....
position 1684 (CDS: 160 - 3324)
Synonym: humS6PKh1; RPK118
NM_001136138.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 3, mRNA. (3566 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatt .....
position 1877 (CDS: 555 - 2063)
Synonym: FAM13C1
NM_001143773.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leupaxin (LPXN), transcript variant 1, mRNA. (1892 bp)
..... attttgtctgtactcattgcaaagaagagattggctccagtcccttctttgag .....
position 679 (CDS: 121 - 1296)
Synonym: LDPL
NM_001143995.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystonin (DST), transcript variant 2, mRNA. (18103 bp)
..... acatgttcaaggtattccagaaagaagagattgaacccttgcaaggtaaacag .....
position 10302 (CDS: 42 - 17069)
Synonym: BP240; BPA; BPAG1; CATX-15; CATX15; D6S1101; DMH; DT; HSAN6; MACF2
NM_001144769.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystonin (DST), transcript variant 3, mRNA. (17774 bp)
..... acatgttcaaggtattccagaaagaagagattgaacccttgcaaggtaaacag .....
position 9973 (CDS: 127 - 16740)
Synonym: BP240; BPA; BPAG1; CATX-15; CATX15; D6S1101; DMH; DT; HSAN6; MACF2
NM_001144770.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 2, mRNA. (7037 bp)
..... acagtcacccatgttagccacaagaagaggttggctgtttatggtttgcacag .....
position 5851 (CDS: 208 - 2136)
Synonym: EF-1a; ERFS; HBS1; HSPC276
NM_001145158.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sperm antigen with calponin homology and coiled-coil domains 1-like (SPECC1L), transcript variant 2, mRNA. (6692 bp)
..... atgacattaaatctgaagcccaagaggagattggtgatctaaagcgccggtta .....
position 2506 (CDS: 205 - 3558)
Synonym: CYTSA; OBLFC1
NM_001145468.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 3, mRNA. (8957 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaactt .....
position 891 (CDS: 192 - 2597)
Synonym: HSSOX6; SOXD
NM_001145811.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 4, mRNA. (8919 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaactt .....
position 772 (CDS: 34 - 2559)
Synonym: HSSOX6; SOXD
NM_001145819.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Nedd4 family interacting protein 2 (NDFIP2), transcript variant 2, mRNA. (4606 bp)
..... gcccatcttaagagatcttgcaggaagagattgtattagatattatatttatt .....
position 1920 (CDS: 81 - 1031)
Synonym: N4WBP5A
NM_001161407.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polo-like kinase 1 substrate 1 (PLK1S1), transcript variant 2, mRNA. (2166 bp)
..... cacgggctgcgggacagtgaaaagaagagattggacctggaaaagaaacttta .....
position 226 (CDS: 280 - 1992)
Synonym: C20orf19; HT013; Kiz; Kizuna; NCRNA00153
NM_001163022.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polo-like kinase 1 substrate 1 (PLK1S1), transcript variant 3, mRNA. (2076 bp)
..... cacgggctgcgggacagtgaaaagaagagattggacctggaaaagaaacttta .....
position 226 (CDS: 280 - 1902)
Synonym: C20orf19; HT013; Kiz; Kizuna; NCRNA00153
NM_001163023.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 2, mRNA. (3418 bp)
..... ctaggtcggcgcccgatcggcaagaagagattagcaaattgatgcgaagtgca .....
position 1167 (CDS: 42 - 2519)
Synonym: EIF2C2; Q10
NM_001164623.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) (UTP14A), transcript variant 2, mRNA. (2421 bp)
..... cagtggagttacctctgaacaaagaagagattgaacgggcaagaactcccctg .....
position 454 (CDS: 91 - 2250)
Synonym: dJ537K23.3; NYCO16; SDCCAG16
NM_001166221.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 4, mRNA. (3477 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatt .....
position 1788 (CDS: 469 - 1974)
Synonym: FAM13C1
NM_001166698.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FRAS1 related extracellular matrix 3 (FREM3), mRNA. (6643 bp)
..... tctgctatatccacacaggccaagaagggattgttgacattatcaagtttgat .....
position 4174 (CDS: 1 - 6420)
NM_001168235.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD300 molecule-like family member g (CD300LG), transcript variant 4, mRNA. (1399 bp)
..... ctgccccaaggctactgctgcaagaagagactgtgccctccgaggccagcact .....
position 1119 (CDS: 70 - 993)
Synonym: CLM-9; CLM9; NEPMUCIN; TREM-4; TREM4
NM_001168322.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD300 molecule-like family member g (CD300LG), transcript variant 3, mRNA. (1297 bp)
..... ctgccccaaggctactgctgcaagaagagactgtgccctccgaggccagcact .....
position 1017 (CDS: 70 - 891)
Synonym: CLM-9; CLM9; NEPMUCIN; TREM-4; TREM4
NM_001168323.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AF4/FMR2 family, member 2 (AFF2), transcript variant 2, mRNA. (13641 bp)
..... atatattctttggatcctgcaaagaagagattggtttattttcttttctggtg .....
position 11171 (CDS: 480 - 4310)
Synonym: FMR2; FMR2P; FRAXE; MRX2; OX19
NM_001169122.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AF4/FMR2 family, member 2 (AFF2), transcript variant 3, mRNA. (13716 bp)
..... atatattctttggatcctgcaaagaagagattggtttattttcttttctggtg .....
position 11246 (CDS: 480 - 4385)
Synonym: FMR2; FMR2P; FRAXE; MRX2; OX19
NM_001169123.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AF4/FMR2 family, member 2 (AFF2), transcript variant 4, mRNA. (13641 bp)
..... atatattctttggatcctgcaaagaagagattggtttattttcttttctggtg .....
position 11171 (CDS: 480 - 4310)
Synonym: FMR2; FMR2P; FRAXE; MRX2; OX19
NM_001169124.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AF4/FMR2 family, member 2 (AFF2), transcript variant 5, mRNA. (13629 bp)
..... atatattctttggatcctgcaaagaagagattggtttattttcttttctggtg .....
position 11159 (CDS: 480 - 4298)
Synonym: FMR2; FMR2P; FRAXE; MRX2; OX19
NM_001169125.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AF4/FMR2 family, member 2 (AFF2), transcript variant 6, mRNA. (12280 bp)
..... atatattctttggatcctgcaaagaagagattggtttattttcttttctggtg .....
position 9810 (CDS: 91 - 2949)
Synonym: FMR2; FMR2P; FRAXE; MRX2; OX19
NM_001170628.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Rho GTPase activating protein 5 (ARHGAP5), transcript variant 2, mRNA. (9601 bp)
..... ttaacactcttttgccaaatctagaagagattgaacatttgaattggtcagaa .....
position 1372 (CDS: 316 - 4821)
Synonym: GFI2; p190-B; p190BRhoGAP; RhoGAP5
NM_001173.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 3, mRNA. (2054 bp)
..... atattttggatacagcaggacaagaagagtttggagccatgagagaacagtat .....
position 222 (CDS: 114 - 623)
Synonym: TC21
NM_001177314.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 4, mRNA. (2186 bp)
..... atattttggatacagcaggacaagaagagtttggagccatgagagaacagtat .....
position 354 (CDS: 372 - 755)
Synonym: TC21
NM_001177315.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 3, mRNA. (7141 bp)
..... gtaagataatagacagccaacaagatgagattgacagaatgattttagaaatt .....
position 1955 (CDS: 68 - 2494)
Synonym: bA57K17.2; C6orf204; NY-BR-15; RP11-57K17.2
NM_001178035.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD8b molecule (CD8B), transcript variant 6, mRNA. (944 bp)
..... cccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccaga .....
position 509 (CDS: 60 - 656)
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_001178100.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myeloid leukemia factor 1 (MLF1), transcript variant 4, mRNA. (2538 bp)
..... ttcttctcagaccatgcaagcaagaagagaatggcatgaaatatataaagtgt .....
position 197 (CDS: 364 - 1263)
NM_001195432.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 3, mRNA. (3621 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaa .....
position 3113 (CDS: 134 - 1705)
Synonym: BT2.2; BTF2
NM_001197237.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 4, mRNA. (1820 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaa .....
position 1291 (CDS: 235 - 1245)
Synonym: BT2.2; BTF2
NM_001197238.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 5, mRNA. (2969 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaa .....
position 2461 (CDS: 112 - 1053)
Synonym: BT2.2; BTF2
NM_001197239.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 6, mRNA. (3470 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaa .....
position 2962 (CDS: 112 - 882)
Synonym: BT2.2; BTF2
NM_001197240.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 1, mRNA. (5496 bp)
..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtac .....
position 2284 (CDS: 199 - 2253)
Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001197294.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 2, mRNA. (1962 bp)
..... cagaggtcacagctaaagtccaggaagagattgatcatgtaattggcagacac .....
position 1103 (CDS: 344 - 1606)
Synonym: CPC8; CYPIIC8; MP-12/MP-20
NM_001198853.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 3, mRNA. (1799 bp)
..... cagaggtcacagctaaagtccaggaagagattgatcatgtaattggcagacac .....
position 940 (CDS: 277 - 1443)
Synonym: CPC8; CYPIIC8; MP-12/MP-20
NM_001198854.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 4, mRNA. (2024 bp)
..... cagaggtcacagctaaagtccaggaagagattgatcatgtaattggcagacac .....
position 1165 (CDS: 406 - 1668)
Synonym: CPC8; CYPIIC8; MP-12/MP-20
NM_001198855.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens bromodomain containing 2 (BRD2), transcript variant 3, mRNA. (4602 bp)
..... cctctttacgtgattcaaacccagaagagattgagattgattttgaaacactc .....
position 3450 (CDS: 1305 - 3815)
Synonym: D6S113E; FSH; FSRG1; NAT; RING3; RNF3
NM_001199455.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens bromodomain containing 2 (BRD2), transcript variant 4, mRNA. (3210 bp)
..... cctctttacgtgattcaaacccagaagagattgagattgattttgaaacactc .....
position 2058 (CDS: 159 - 2423)
Synonym: D6S113E; FSH; FSRG1; NAT; RING3; RNF3
NM_001199456.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 16, member 4 (monocarboxylic acid transporter 5) (SLC16A4), transcript variant 2, mRNA. (2485 bp)
..... caattttctttgtggtctttcaagaagagtttgaaggcacctcagagcaaatt .....
position 395 (CDS: 251 - 1570)
Synonym: MCT4; MCT5
NM_001201546.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 16, member 4 (monocarboxylic acid transporter 5) (SLC16A4), transcript variant 5, mRNA. (2125 bp)
..... caattttctttgtggtctttcaagaagagtttgaaggcacctcagagcaaatt .....
position 395 (CDS: 251 - 1210)
Synonym: MCT4; MCT5
NM_001201549.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 4, mRNA. (13882 bp)
..... cgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagc .....
position 341 (CDS: 128 - 4678)
Synonym: CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75
NM_001202543.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 6, mRNA. (2901 bp)
..... cgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagc .....
position 341 (CDS: 128 - 2026)
Synonym: CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75
NM_001202545.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 7, mRNA. (2818 bp)
..... cgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagc .....
position 126 (CDS: 24 - 1943)
Synonym: CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75
NM_001202546.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens potassium voltage-gated channel, KQT-like subfamily, member 3 (KCNQ3), transcript variant 2, mRNA. (10717 bp)
..... ggattctaagatacacagagcaagaagagattttgatcacccagaacaaccac .....
position 7790 (CDS: 37 - 2295)
Synonym: BFNC2; EBN2; KV7.3
NM_001204824.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cysteine-rich secretory protein 1 (CRISP1), transcript variant 3, mRNA. (1903 bp)
..... tcaccgacttgccaaatgtacaagaagagatcgttaatatacacaacgccctc .....
position 211 (CDS: 91 - 840)
Synonym: AEGL1; ARP; CRISP-1; HSCRISP1D; HSCRISP1G; HUMARP
NM_001205220.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 3, mRNA. (3383 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttg .....
position 1140 (CDS: 186 - 2429)
Synonym: CALCOCO3; T6BP; TXBP151
NM_001206901.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 4, mRNA. (3192 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttg .....
position 949 (CDS: 466 - 2238)
Synonym: CALCOCO3; T6BP; TXBP151
NM_001206902.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript variant 2, mRNA. (3740 bp)
..... ggacaggtactgctctataccaagaagagaatgattctttggaaattgttatt .....
position 2668 (CDS: 299 - 865)
Synonym: LHX; RAB2
NM_001242644.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 3, member A3 (BTN3A3), transcript variant 3, mRNA. (2364 bp)
aatcaaaaaactaattcttccaaaaagagattgttattattcctcacaataac .....
position 21 (CDS: 219 - 1343)
Synonym: BTF3
NM_001242803.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens adaptor-related protein complex 2, alpha 2 subunit (AP2A2), transcript variant 1, mRNA. (4674 bp)
..... agacagctgactactccatccgagaagagattgtgctgaaggtcgccatcctg .....
position 1474 (CDS: 214 - 3036)
Synonym: ADTAB; CLAPA2; HIP-9; HIP9; HYPJ
NM_001242837.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitogen-activated protein kinase kinase kinase 8 (MAP3K8), transcript variant 2, mRNA. (2782 bp)
..... tgagcactggaagtgacaataaagaagagattgatttattaattaaacattta .....
position 412 (CDS: 382 - 1785)
Synonym: c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2
NM_001244134.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens C7orf55-LUC7L2 readthrough (C7orf55-LUC7L2), mRNA. (2747 bp)
..... agaaaagattagcagaaactcaagaagagattagtgctgaagtagcagcaaag .....
position 785 (CDS: 254 - 1630)
NM_001244584.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LUC7-like 2 (S. cerevisiae) (LUC7L2), transcript variant 3, mRNA. (2471 bp)
..... agaaaagattagcagaaactcaagaagagattagtgctgaagtagcagcaaag .....
position 509 (CDS: 185 - 1354)
Synonym: CGI-59; CGI-74; LUC7B2
NM_001244585.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SET nuclear oncogene (SET), transcript variant 3, mRNA. (2638 bp)
..... ccttgctggaaaaagaacagcaagaagcgattgaacacattgatgaagtacaa .....
position 140 (CDS: 83 - 889)
Synonym: 2PP2A; I2PP2A; IGAAD; IPP2A2; PHAPII; TAF-I; TAF-IBETA
NM_001248000.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SET nuclear oncogene (SET), transcript variant 4, mRNA. (2562 bp)
..... cgccacatgaaaaagaacagcaagaagcgattgaacacattgatgaagtacaa .....
position 64 (CDS: 13 - 813)
Synonym: 2PP2A; I2PP2A; IGAAD; IPP2A2; PHAPII; TAF-I; TAF-IBETA
NM_001248001.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens small integral membrane protein 22 (SMIM22), transcript variant 1, mRNA. (1032 bp)
..... ttaagttgcagcgtcaaaaacatgaagagattgctttagcaaatatttaccca .....
position 270 (CDS: 521 - 772)
NM_001253790.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sperm antigen with calponin homology and coiled-coil domains 1-like (SPECC1L), transcript variant 3, mRNA. (6575 bp)
..... atgacattaaatctgaagcccaagaggagattggtgatctaaagcgccggtta .....
position 2506 (CDS: 205 - 3441)
Synonym: CYTSA; OBLFC1
NM_001254732.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chitinase 1 (chitotriosidase) (CHIT1), transcript variant 2, mRNA. (2268 bp)
..... acagccccctctacaagaggcaagaagagagtggtgcagcagccagcctcaac .....
position 733 (CDS: 97 - 1440)
Synonym: CHI3; CHIT; CHITD
NM_001256125.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9), transcript variant 2, mRNA. (2640 bp)
..... tctgacgtgttttatttctccaagaagggattggaagccattgtagaagatga .....
position 519 (CDS: 220 - 1524)
Synonym: AGPAT8; GPAT3; HMFN0839; LPAAT-theta; MAG1
NM_001256421.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9), transcript variant 3, mRNA. (2644 bp)
..... tctgacgtgttttatttctccaagaagggattggaagccattgtagaagatga .....
position 523 (CDS: 224 - 1528)
Synonym: AGPAT8; GPAT3; HMFN0839; LPAAT-theta; MAG1
NM_001256422.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 3, mRNA. (5713 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 542 (CDS: 738 - 1553)
Synonym: ENH; ENH1; L9; LIM
NM_001256425.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 6, mRNA. (6219 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 652 (CDS: 182 - 2059)
Synonym: ENH; ENH1; L9; LIM
NM_001256426.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 7, mRNA. (3834 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 652 (CDS: 182 - 1633)
Synonym: ENH; ENH1; L9; LIM
NM_001256427.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 8, mRNA. (5980 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 809 (CDS: 396 - 1820)
Synonym: ENH; ENH1; L9; LIM
NM_001256428.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens golgin B1 (GOLGB1), transcript variant 1, mRNA. (11243 bp)
..... tttgtgaaatgaagcaaaaaccagaagagattggagaagaaagtagagcaaag .....
position 4555 (CDS: 139 - 9948)
Synonym: GCP; GCP372; GOLIM1
NM_001256486.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens golgin B1 (GOLGB1), transcript variant 3, mRNA. (11256 bp)
..... tttgtgaaatgaagcaaaaaccagaagagattggagaagaaagtagagcaaag .....
position 4583 (CDS: 284 - 9961)
Synonym: GCP; GCP372; GOLIM1
NM_001256487.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens golgin B1 (GOLGB1), transcript variant 4, mRNA. (11133 bp)
..... tttgtgaaatgaagcaaaaaccagaagagattggagaagaaagtagagcaaag .....
position 4460 (CDS: 284 - 9838)
Synonym: GCP; GCP372; GOLIM1
NM_001256488.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptosomal-associated protein, 91kDa (SNAP91), transcript variant 6, mRNA. (4529 bp)
..... tcacagtattatttatttctcaagaagagatttgttcatcatagtagtattag .....
position 426 (CDS: 655 - 3105)
Synonym: AP180; CALM
NM_001256717.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NOP2 nucleolar protein (NOP2), transcript variant 3, mRNA. (2716 bp)
..... cgtgctcgaaagagggcagccaagaggagattgggctctgttgaagcccctaa .....
position 286 (CDS: 131 - 2569)
Synonym: NOL1; NOP120; NSUN1; p120
NM_001258308.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NOP2 nucleolar protein (NOP2), transcript variant 4, mRNA. (2815 bp)
..... cgtgctcgaaagagggcagccaagaggagattgggctctgttgaagcccctaa .....
position 286 (CDS: 131 - 2668)
Synonym: NOL1; NOP120; NSUN1; p120
NM_001258309.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NOP2 nucleolar protein (NOP2), transcript variant 5, mRNA. (2826 bp)
..... cgtgctcgaaagagggcagccaagaggagattgggctctgttgaagcccctaa .....
position 286 (CDS: 131 - 2017)
Synonym: NOL1; NOP120; NSUN1; p120
NM_001258310.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 5 (SOX5), transcript variant 4, mRNA. (4317 bp)
..... caagcaaacaacaatatcaacaacaagagattgaaataagctatgggtaaaat .....
position 2589 (CDS: 450 - 2378)
Synonym: L-SOX5
NM_001261414.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 5 (SOX5), transcript variant 5, mRNA. (4357 bp)
..... caagcaaacaacaatatcaacaacaagagattgaaataagctatgggtaaaat .....
position 2629 (CDS: 157 - 2418)
Synonym: L-SOX5
NM_001261415.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens enkurin, TRPC channel interacting protein (ENKUR), transcript variant 2, mRNA. (3312 bp)
..... agcaacaagtcctacttgctcaagaagagaatgactcaatacgcaggattagg .....
position 59 (CDS: 320 - 904)
Synonym: C10orf63
NM_001270383.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chitinase 1 (chitotriosidase) (CHIT1), transcript variant 5, mRNA. (2190 bp)
..... acagccccctctacaagaggcaagaagagagtggtgcagcagccagcctcaac .....
position 742 (CDS: 97 - 1362)
Synonym: CHI3; CHIT; CHITD
NM_001270509.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LUC7-like 2 (S. cerevisiae) (LUC7L2), transcript variant 4, mRNA. (2783 bp)
..... agaaaagattagcagaaactcaagaagagattagtgctgaagtagcagcaaag .....
position 821 (CDS: 491 - 1666)
Synonym: CGI-59; CGI-74; LUC7B2
NM_001270643.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 2, mRNA. (2525 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgt .....
position 2277 (CDS: 69 - 2327)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271696.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 3, mRNA. (2405 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgt .....
position 2157 (CDS: 69 - 2207)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271697.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 4, mRNA. (2447 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgt .....
position 2199 (CDS: 69 - 2249)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271698.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 5, mRNA. (2408 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgt .....
position 2160 (CDS: 69 - 2210)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271699.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2, mRNA. (6291 bp)
..... gaagacaaagtaccactgataaagaagagattgtcaaatagatgcattcctag .....
position 5353 (CDS: 206 - 1120)
Synonym: DUBA8; OTUD2; PRO0907; RP11-164O23.1
NM_001276320.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine zipper transcription factor-like 1 (LZTFL1), transcript variant 2, mRNA. (4356 bp)
..... acaaggaaattttaagacttcaagaagagaatgagaaattgaagtcaaggttg .....
position 920 (CDS: 500 - 1348)
Synonym: BBS17
NM_001276378.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine zipper transcription factor-like 1 (LZTFL1), transcript variant 3, mRNA. (4127 bp)
..... acaaggaaattttaagacttcaagaagagaatgagaaattgaagtcaaggttg .....
position 795 (CDS: 336 - 1106)
Synonym: BBS17
NM_001276379.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens nuclear receptor subfamily 5, group A, member 2 (NR5A2), transcript variant 3, mRNA. (4787 bp)
..... taggagctctgctttcaaaacaaaaagagattgggggagtggggagggggaag .....
position 1597 (CDS: 156 - 1565)
Synonym: B1F; B1F2; CPF; FTF; FTZ-F1; FTZ-F1beta; hB1F-2; LRH-1; LRH1
NM_001276464.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitogen-activated protein kinase 14 (MAPK14), transcript variant 1, mRNA. (4353 bp)
..... ttgtgccaccaccccttgaccaagaagagatggagtcctgagcacctggtttc .....
position 1544 (CDS: 482 - 1564)
Synonym: CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; p38; p38ALPHA; PRKM14; PRKM15; RK; SAPK2A
NM_001315.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 1, mRNA. (3621 bp)
..... aacttgactgatgtaagtgtcaagaaaagattgacattttgttaaaacttcgt .....
position 3161 (CDS: 414 - 1385)
Synonym: AKR1C-pseudo; BABP; DD; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8
NM_001354.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 2, mRNA. (5066 bp)
..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtac .....
position 1854 (CDS: 111 - 1823)
Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001387.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens carboxypeptidase A3 (mast cell) (CPA3), mRNA. (1699 bp)
..... aaatcttgattcatgatctacaagaagagattgagaaacagtttgatgttaaa .....
position 341 (CDS: 53 - 1306)
Synonym: MC-CPA
NM_001870.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 2, mRNA. (3039 bp)
..... cgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagc .....
position 341 (CDS: 128 - 2164)
Synonym: CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75
NM_001913.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens AF4/FMR2 family, member 2 (AFF2), transcript variant 1, mRNA. (13746 bp)
..... atatattctttggatcctgcaaagaagagattggtttattttcttttctggtg .....
position 11276 (CDS: 480 - 4415)
Synonym: FMR2; FMR2P; FRAXE; MRX2; OX19
NM_002025.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kinesin family member 3C (KIF3C), mRNA. (5431 bp)
..... acacactgctgcgggaattccaagaggagattgcccgcctgaaggcccagctg .....
position 1807 (CDS: 658 - 3039)
NM_002254.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 2, mRNA. (7355 bp)
..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttg .....
position 4917 (CDS: 399 - 5849)
Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_002290.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leukemia inhibitory factor receptor alpha (LIFR), transcript variant 2, mRNA. (10107 bp)
..... cctgagataatgagaaaaggccagaagagattgtttgatctctgtctgtcaat .....
position 5508 (CDS: 165 - 3458)
Synonym: CD118; LIF-R; SJS2; STWS; SWS
NM_002310.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens microtubule-associated protein 2 (MAP2), transcript variant 1, mRNA. (9445 bp)
..... ctccagaatcatctctaattcaagatgagattgccgtcaaattgtcagtggaa .....
position 3732 (CDS: 249 - 5732)
Synonym: MAP2A; MAP2B; MAP2C
NM_002374.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens prefoldin subunit 4 (PFDN4), mRNA. (1383 bp)
..... aagaagcaaagaaaaatttgcaagaagaaattgacgccttagaatccagagtg .....
position 421 (CDS: 139 - 543)
Synonym: C1; PFD4
NM_002623.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript variant 1, mRNA. (3812 bp)
..... ggacaggtactgctctataccaagaagagaatgattctttggaaattgttatt .....
position 2740 (CDS: 299 - 937)
Synonym: LHX; RAB2
NM_002865.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens UPF1 regulator of nonsense transcripts homolog (yeast) (UPF1), mRNA. (5360 bp)
..... tcttctacgtgacccagggccaagaggagattgccagctcgggcacctcctac .....
position 2535 (CDS: 276 - 3632)
Synonym: HUPF1; NORF1; pNORF1; RENT1; smg-2
NM_002911.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens c-ros oncogene 1 , receptor tyrosine kinase (ROS1), mRNA. (7368 bp)
..... caatacatactcttccaacccaagaggagattgaaaatcttcctgccttccct .....
position 5990 (CDS: 200 - 7243)
Synonym: c-ros-1; MCF3; ROS
NM_002944.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SET nuclear oncogene (SET), transcript variant 2, mRNA. (2936 bp)
..... agacctcagaaaaagaacagcaagaagcgattgaacacattgatgaagtacaa .....
position 438 (CDS: 354 - 1187)
Synonym: 2PP2A; I2PP2A; IGAAD; IPP2A2; PHAPII; TAF-I; TAF-IBETA
NM_003011.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens spectrin, alpha, erythrocytic 1 (elliptocytosis 2) (SPTA1), mRNA. (8017 bp)
..... ttgctgatgaacactatgccaaagaagagattgctacgcggctccaacgtgta .....
position 4601 (CDS: 200 - 7459)
Synonym: EL2; HPP; HS3; SPH3; SPTA
NM_003126.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens suppressor of Ty 5 homolog (S. cerevisiae) (SUPT5H), transcript variant 1, mRNA. (3798 bp)
..... gagcagaggacattctagagaaagaagagattgaagcctccaatatcgataat .....
position 547 (CDS: 244 - 3507)
Synonym: SPT5; SPT5H; Tat-CT1
NM_003169.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vimentin (VIM), mRNA. (2151 bp)
..... aacgcaaagtggaatctttgcaagaagagattgcctttttgaagaaactccac .....
position 1095 (CDS: 414 - 1814)
NM_003380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chitinase 1 (chitotriosidase) (CHIT1), transcript variant 1, mRNA. (2325 bp)
..... acagccccctctacaagaggcaagaagagagtggtgcagcagccagcctcaac .....
position 790 (CDS: 97 - 1497)
Synonym: CHI3; CHIT; CHITD
NM_003465.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens KH-type splicing regulatory protein (KHSRP), mRNA. (3262 bp)
..... ctgttgtcttttcatctgttcaagaggagattgaaactgaaaacaaaatgaga .....
position 2899 (CDS: 111 - 2246)
Synonym: FBP2; FUBP2; KSRP
NM_003685.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens eukaryotic translation initiation factor 3, subunit B (EIF3B), transcript variant 1, mRNA. (3009 bp)
..... ccttctatgggtcttttggacaagaagagtttgaagatctctgggataaaaga .....
position 1457 (CDS: 84 - 2528)
Synonym: EIF3-ETA; EIF3-P110; EIF3-P116; EIF3S9; PRT1
NM_003751.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin, heavy chain 13, skeletal muscle (MYH13), mRNA. (5992 bp)
..... ggcgagagaacaaaaatctgcaagaagagatttccgacttaactgagcagatt .....
position 4618 (CDS: 91 - 5907)
Synonym: MyHC-eo
NM_003802.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase 1 (RIPK1), mRNA. (3864 bp)
..... ctccttccctggagcacccacaagaagagaatgagcccagcctgcagagtaaa .....
position 1099 (CDS: 1 - 2016)
Synonym: RIP; RIP1
NM_003804.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens nuclear receptor subfamily 5, group A, member 2 (NR5A2), transcript variant 2, mRNA. (4956 bp)
..... taggagctctgctttcaaaacaaaaagagattgggggagtggggagggggaag .....
position 1766 (CDS: 247 - 1734)
Synonym: B1F; B1F2; CPF; FTF; FTZ-F1; FTZ-F1beta; hB1F-2; LRH-1; LRH1
NM_003822.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA. (13993 bp)
..... ttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctg .....
position 5096 (CDS: 245 - 11302)
Synonym: BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272
NM_004006.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystrophin (DMD), transcript variant Dp427l, mRNA. (13764 bp)
..... ttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctg .....
position 4867 (CDS: 385 - 11073)
Synonym: BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272
NM_004007.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystrophin (DMD), transcript variant Dp427p1, mRNA. (14000 bp)
..... ttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctg .....
position 5103 (CDS: 264 - 11309)
Synonym: BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272
NM_004009.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystrophin (DMD), transcript variant Dp427p2, mRNA. (14083 bp)
..... ttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctg .....
position 5186 (CDS: 704 - 11392)
Synonym: BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272
NM_004010.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystrophin (DMD), transcript variant Dp260-1, mRNA. (9771 bp)
..... ttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctg .....
position 874 (CDS: 46 - 7080)
Synonym: BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272
NM_004011.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystrophin (DMD), transcript variant Dp260-2, mRNA. (9914 bp)
..... ttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctg .....
position 1017 (CDS: 198 - 7223)
Synonym: BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272
NM_004012.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 1, mRNA. (2528 bp)
..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgt .....
position 2280 (CDS: 69 - 2330)
Synonym: ABC7; ASAT; Atm1p; EST140535
NM_004299.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type XII, alpha 1 (COL12A1), transcript variant long, mRNA. (11579 bp)
..... cagttaaatgcacacagagacaagaagagcttgttgcaagctgtggcaaactt .....
position 3940 (CDS: 167 - 9358)
Synonym: BA209D8.1; COL12A1L; DJ234P15.1
NM_004370.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens flotillin 2 (FLOT2), mRNA. (2659 bp)
..... gtgaacagcagaagatccggcaggaagagattgagattgaggttgtgcagcgc .....
position 883 (CDS: 124 - 1410)
Synonym: ECS-1; ECS1; ESA; ESA1; M17S1
NM_004475.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens golgin B1 (GOLGB1), transcript variant 2, mRNA. (11213 bp)
..... tttgtgaaatgaagcaaaaaccagaagagattggagaagaaagtagagcaaag .....
position 4540 (CDS: 139 - 9918)
Synonym: GCP; GCP372; GOLIM1
NM_004487.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens potassium voltage-gated channel, KQT-like subfamily, member 3 (KCNQ3), transcript variant 1, mRNA. (11266 bp)
..... ggattctaagatacacagagcaagaagagattttgatcacccagaacaaccac .....
position 8339 (CDS: 226 - 2844)
Synonym: BFNC2; EBN2; KV7.3
NM_004519.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 16, member 4 (monocarboxylic acid transporter 5) (SLC16A4), transcript variant 1, mRNA. (2629 bp)
..... caattttctttgtggtctttcaagaagagtttgaaggcacctcagagcaaatt .....
position 395 (CDS: 251 - 1714)
Synonym: MCT4; MCT5
NM_004696.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Rho guanine nucleotide exchange factor (GEF) 1 (ARHGEF1), transcript variant 2, mRNA. (3236 bp)
..... ttcaagaacctggacatcaccaagaagaaattggtccacgagggcccactgac .....
position 2041 (CDS: 110 - 2848)
Synonym: GEF1; LBCL2; LSC; P115-RHOGEF; SUB1.5
NM_004706.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA. (3883 bp)
..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgc .....
position 1109 (CDS: 216 - 2624)
Synonym: MSK1; MSPK1; RLPK
NM_004755.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens potassium voltage-gated channel, Shab-related subfamily, member 2 (KCNB2), mRNA. (3597 bp)
..... ctgagaggccatctgcatatgaagaagagattgaaatggaagaagtggtgtgt .....
position 2299 (CDS: 589 - 3324)
Synonym: KV2.2
NM_004770.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kinesin family member 3B (KIF3B), mRNA. (6135 bp)
..... atgccctccttcgagaattccaggaagagattgctcggctcaaggcccagctg .....
position 1255 (CDS: 181 - 2424)
Synonym: FLA8; HH0048; KLP-11
NM_004798.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leupaxin (LPXN), transcript variant 2, mRNA. (1926 bp)
..... attttgtctgtactcattgcaaagaagagattggctccagtcccttctttgag .....
position 689 (CDS: 146 - 1306)
Synonym: LDPL
NM_004811.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD8b molecule (CD8B), transcript variant 5, mRNA. (1433 bp)
..... cccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccaga .....
position 509 (CDS: 60 - 692)
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_004931.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens A kinase (PRKA) anchor protein 12 (AKAP12), transcript variant 1, mRNA. (8450 bp)
..... atgagaaaatagaagtccaccaagaagaggttgtggccgaagtccacgtcagc .....
position 1474 (CDS: 241 - 5589)
Synonym: AKAP250; SSeCKS
NM_005100.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens bromodomain containing 2 (BRD2), transcript variant 1, mRNA. (4907 bp)
..... cctctttacgtgattcaaacccagaagagattgagattgattttgaaacactc .....
position 3742 (CDS: 1702 - 4107)
Synonym: D6S113E; FSH; FSRG1; NAT; RING3; RNF3
NM_005104.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitogen-activated protein kinase kinase kinase 8 (MAP3K8), transcript variant 1, mRNA. (3013 bp)
..... tgagcactggaagtgacaataaagaagagattgatttattaattaaacattta .....
position 643 (CDS: 613 - 2016)
Synonym: c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2
NM_005204.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LIM domain 7 (LMO7), transcript variant 1, mRNA. (7253 bp)
..... caaatcgagtcactgtcaagcaagaagagactgacaggagagtgaaaaatgtt .....
position 1735 (CDS: 1261 - 5310)
Synonym: FBX20; FBXO20; LOMP
NM_005358.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ecotropic viral integration site 5 (EVI5), mRNA. (7403 bp)
..... taagtgaagcaaagcgtaaacaagcagagattgaatgcaagaataaggaagaa .....
position 1916 (CDS: 11 - 2443)
Synonym: NB4S
NM_005665.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 239 (ZNF239), transcript variant 1, mRNA. (2406 bp)
..... atgacaactcagcaatgacacaagaagagagtgacacagaaagattcagtagc .....
position 169 (CDS: 654 - 2030)
Synonym: HOK-2; MOK2
NM_005674.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens phenylalanyl-tRNA synthetase, beta subunit (FARSB), mRNA. (2233 bp)
..... ttacctttgccctgtgctcccaagaagatattgctgataaactaggtgtggat .....
position 1293 (CDS: 36 - 1805)
Synonym: FARSLB; FRSB; HSPC173; PheHB; PheRS
NM_005687.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kinesin family member 20A (KIF20A), mRNA. (3471 bp)
..... agtcactgacaagtttttaccaagaagagattcaggagcgggatgaaaagatt .....
position 2408 (CDS: 497 - 3169)
Synonym: MKLP2; RAB6KIFL
NM_005733.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9), transcript variant 2, mRNA. (12463 bp)
..... ataaattactaggagaattacaagaacagattgtgcaaaagaaccaagaaata ..... gagaagaccaggaacagctacaagaagagattaagagacttaatagacaatta .....
position 1312 5104 (CDS: 226 - 11949)
Synonym: AKAP-9; AKAP350; AKAP450; CG-NAP; HYPERION; LQT11; MU-RMS-40.16A; PPP1R45; PRKA9; YOTIAO
NM_005751.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 1, mRNA. (3506 bp)
..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttg .....
position 1137 (CDS: 183 - 2552)
Synonym: CALCOCO3; T6BP; TXBP151
NM_006024.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NOP2 nucleolar protein (NOP2), transcript variant 1, mRNA. (2704 bp)
..... cgtgctcgaaagagggcagccaagaggagattgggctctgttgaagcccctaa .....
position 286 (CDS: 131 - 2557)
Synonym: NOL1; NOP120; NSUN1; p120
NM_006170.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens protein phosphatase 2, regulatory subunit B', beta (PPP2R5B), mRNA. (2766 bp)
..... ggggagggggagggcacaggcaagaagagattcacagtgtcctggggtaaggg .....
position 2643 (CDS: 623 - 2116)
Synonym: B56B; PR61B
NM_006244.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens intersectin 2 (ITSN2), transcript variant 1, mRNA. (6112 bp)
..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaag .....
position 1690 (CDS: 259 - 5352)
Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_006277.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 1, mRNA. (6132 bp)
..... cccactcacagtgatgccagcaagaagagactgattgaggatactgaagactg .....
position 961 (CDS: 182 - 1972)
Synonym: ENH; ENH1; L9; LIM
NM_006457.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1, mRNA. (1914 bp)
..... tttccacttcctgaccgccgccagaagagattgattttctccactatcactag .....
position 1215 (CDS: 199 - 1455)
Synonym: MIP224; RPT3; S6; TBP-7; TBP7
NM_006503.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 1, mRNA. (7163 bp)
..... acagtcacccatgttagccacaagaagaggttggctgtttatggtttgcacag .....
position 5977 (CDS: 208 - 2262)
Synonym: EF-1a; ERFS; HBS1; HSPC276
NM_006620.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens IQ motif containing GTPase activating protein 2 (IQGAP2), mRNA. (5769 bp)
..... gaaaatcatttttgcatgaacaagaagagaatgtggtcaaaatacaggctttt .....
position 2290 (CDS: 223 - 4950)
NM_006633.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) (UTP14A), transcript variant 1, mRNA. (2577 bp)
..... cagtggagttacctctgaacaaagaagagattgaacggatccacagagaagta .....
position 454 (CDS: 91 - 2406)
Synonym: dJ537K23.3; NYCO16; SDCCAG16
NM_006649.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ralA binding protein 1 (RALBP1), mRNA. (4368 bp)
..... gccggcagattgcctcagaaaaagaagagattgaacgcctcagagctgagatt .....
position 1746 (CDS: 216 - 2183)
Synonym: RIP1; RLIP1; RLIP76
NM_006788.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens splicing factor 3b, subunit 2, 145kDa (SF3B2), mRNA. (2902 bp)
..... aatttcagaccaagactgaggaagaagagattgatcggaccccttggggggaa .....
position 2138 (CDS: 41 - 2728)
Synonym: Cus1; SAP145; SF3b1; SF3B145; SF3b150
NM_006842.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 5 (SOX5), transcript variant 1, mRNA. (4333 bp)
..... caagcaaacaacaatatcaacaacaagagattgaaataagctatgggtaaaat .....
position 2605 (CDS: 103 - 2394)
Synonym: L-SOX5
NM_006940.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 3, member A3 (BTN3A3), transcript variant 1, mRNA. (3019 bp)
aatcaaaaaactaattcttccaaaaagagattgttattattcctcacaataac .....
position 21 (CDS: 244 - 1998)
Synonym: BTF3
NM_006994.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 1, mRNA. (3602 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaa .....
position 3091 (CDS: 112 - 1683)
Synonym: BT2.2; BTF2
NM_006995.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transcription factor Dp-1 (TFDP1), transcript variant 1, mRNA. (2651 bp)
..... gtttccttttggcctactcccaagaagatattggtaagctattgaatttagat .....
position 1541 (CDS: 213 - 1445)
Synonym: Dp-1; DP1; DRTF1
NM_007111.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 1, mRNA. (3520 bp)
..... ctaggtcggcgcccgatcggcaagaagagattagcaaattgatgcgaagtgca .....
position 1167 (CDS: 42 - 2621)
Synonym: EIF2C2; Q10
NM_012154.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 1, mRNA. (2360 bp)
..... atattttggatacagcaggacaagaagagtttggagccatgagagaacagtat .....
position 528 (CDS: 315 - 929)
Synonym: TC21
NM_012250.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens adaptor-related protein complex 2, alpha 2 subunit (AP2A2), transcript variant 2, mRNA. (4671 bp)
..... agacagctgactactccatccgagaagagattgtgctgaaggtcgccatcctg .....
position 1471 (CDS: 214 - 3033)
Synonym: ADTAB; CLAPA2; HIP-9; HIP9; HYPJ
NM_012305.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 52kDa, polypeptide 1 (RPS6KC1), transcript variant 1, mRNA. (4206 bp)
..... cattatgcaatgaatatgggcaagaaaagattgaaccagggtctttgaatgag .....
position 1720 (CDS: 160 - 3360)
Synonym: humS6PKh1; RPK118
NM_012424.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens stromal antigen 3 (STAG3), mRNA. (4285 bp)
..... gcaaagagctccaagagcatcaagaggagattgaggggatgatgaatgccctc .....
position 1035 (CDS: 156 - 3833)
NM_012447.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATPase, H+ transporting, lysosomal V0 subunit a2 (ATP6V0A2), mRNA. (6550 bp)
..... tataaatgaagatattttaccatgaagagattgcacttatccttgagaacagt ..... tataaatgaagatattttaccatgaagagattgcacttatccttgagaacagt .....
position 3995 4053 (CDS: 249 - 2819)
Synonym: A2; ARCL; ARCL2A; ATP6A2; ATP6N1D; J6B7; RTF; STV1; TJ6; TJ6M; TJ6S; VPH1; WSS
NM_012463.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitochondrial ribosomal protein S18B (MRPS18B), mRNA. (1536 bp)
..... ggctttaccagggtcatctccaagaagagagtggccccccacctgagtcaatg .....
position 830 (CDS: 158 - 934)
Synonym: C6orf14; HSPC183; HumanS18a; MRP-S18-2; MRPS18-2; PTD017; S18amt
NM_014046.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 8 (DNAJC8), mRNA. (1765 bp)
..... atgaaaggaaacgacaaagggaagaagagattgaagctcaagaaaaagccaaa .....
position 610 (CDS: 34 - 795)
Synonym: HSPC331; SPF31
NM_014280.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens lysine (K)-specific methyltransferase 2B (KMT2B), mRNA. (8469 bp)
..... tgctggggactgagcccttccaggaagagattgtagccgctggggccatgggg .....
position 6010 (CDS: 1 - 8148)
Synonym: HRX2; MLL1B; MLL2; MLL4; TRX2; WBP7
NM_014727.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA. (2807 bp)
..... accagggggagagaccagaccaagaagagaatggccaagcccaaaaaccgggc .....
position 590 (CDS: 489 - 2387)
Synonym: ALEX2
NM_014782.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) (FIG4), mRNA. (3123 bp)
..... tgaagaaattccacaaatatgaagaagagattgatatccacaatgagttcttt .....
position 2217 (CDS: 216 - 2939)
Synonym: ALS11; CMT4J; dJ249I4.1; KIAA0274; RP1-249I4.1; SAC3; YVS
NM_014845.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens PDGFA associated protein 1 (PDAP1), mRNA. (2707 bp)
..... aggagctttcgaggagagaacgagaagagattgagaagcagaaggcaaaagag .....
position 468 (CDS: 135 - 680)
Synonym: HASPP28; PAP; PAP1
NM_014891.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens myosin, heavy chain 15 (MYH15), mRNA. (7074 bp)
..... ggagggagaacaagaacctccaagaagagatttctaatctgacaaaccaggtt .....
position 4609 (CDS: 58 - 5898)
NM_014981.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens microtubule associated tumor suppressor candidate 2 (MTUS2), transcript variant 2, mRNA. (4009 bp)
..... gttgagaaggaaacccaggagaagaagagattgagccgaaccaatgaagagct .....
position 1094 (CDS: 204 - 1250)
Synonym: CAZIP; ICIS; KIAA0774; TIP150
NM_015233.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sperm antigen with calponin homology and coiled-coil domains 1-like (SPECC1L), transcript variant 1, mRNA. (6796 bp)
..... atgacattaaatctgaagcccaagaggagattggtgatctaaagcgccggtta .....
position 2610 (CDS: 309 - 3662)
Synonym: CYTSA; OBLFC1
NM_015330.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5), mRNA. (4582 bp)
..... cttaaagggcttgggaataacaagaagagattgaagacagagaagcttgccct .....
position 451 (CDS: 1257 - 3404)
Synonym: DHHC5; ZNF375
NM_015457.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystonin (DST), transcript variant 1eA, mRNA. (16652 bp)
..... acatgttcaaggtattccagaaagaagagattgaacccttgcaaggtaaacag .....
position 8857 (CDS: 109 - 15624)
Synonym: BP240; BPA; BPAG1; CATX-15; CATX15; D6S1101; DMH; DT; HSAN6; MACF2
NM_015548.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LIM domain 7 (LMO7), transcript variant 2, mRNA. (6791 bp)
..... caaatcgagtcactgtcaagcaagaagagactgacaggagagtgaaaaatgtt .....
position 380 (CDS: 761 - 4918)
Synonym: FBX20; FBXO20; LOMP
NM_015842.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens LUC7-like 2 (S. cerevisiae) (LUC7L2), transcript variant 1, mRNA. (2712 bp)
..... agaaaagattagcagaaactcaagaagagattagtgctgaagtagcagcaaag .....
position 750 (CDS: 417 - 1595)
Synonym: CGI-59; CGI-74; LUC7B2
NM_016019.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens F-box protein 40 (FBXO40), mRNA. (5722 bp)
..... ttccattaagagctaagaagcaagaagaaattggggcgccatggggaaagccc .....
position 191 (CDS: 211 - 2340)
Synonym: FBX40
NM_016298.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transcription factor Dp family, member 3 (TFDP3), mRNA. (1680 bp)
..... gtttcttttttgcctactcccaagaagatattggtaagctatagaatttagat .....
position 1410 (CDS: 90 - 1307)
Synonym: CT30; DP4; HCA661
NM_016521.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 1, mRNA. (8979 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaactt .....
position 913 (CDS: 205 - 2619)
Synonym: HSSOX6; SOXD
NM_017508.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens INO80 complex subunit D (INO80D), mRNA. (14136 bp)
..... gtttgtaatttccctttaaacaagaagagatggctcacattttccatatatat .....
position 13847 (CDS: 406 - 3489)
NM_017759.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens NRDE-2, necessary for RNA interference, domain containing (NRDE2), mRNA. (4026 bp)
..... tggtgcctgcacactaaaaacaagaagagattaaagtctcaagggaagaactg .....
position 2489 (CDS: 234 - 3728)
Synonym: C14orf102
NM_017970.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA. (6873 bp)
..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaatt .....
position 2973 (CDS: 105 - 4355)
Synonym: NUCLING
NM_018003.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ubiquitin specific peptidase 40 (USP40), mRNA. (5623 bp)
..... atctgaaagatctccagagtgaagaagagattgatcatccactgatgattcta .....
position 1048 (CDS: 1 - 3744)
NM_018218.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 2-oxoglutarate and iron-dependent oxygenase domain containing 1 (OGFOD1), mRNA. (3020 bp)
..... tggattaccaagttcaaattcaagaagagtttgaagaaagttctgaaattctc .....
position 951 (CDS: 102 - 1730)
Synonym: TPA1
NM_018233.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB (BDP1), mRNA. (11097 bp)
..... gacatctctggaggtttcagcaagaaaagattgtgtaggttccaaagagtctg .....
position 5494 (CDS: 264 - 8138)
Synonym: HSA238520; TAF3B1; TFC5; TFIIIB''; TFIIIB150; TFIIIB90; TFNR
NM_018429.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger CCCH-type containing 15 (ZC3H15), mRNA. (2149 bp)
..... cctggaagaaaaggaaaagacaagaaaagattgataaacttgaacaagatatg .....
position 1015 (CDS: 226 - 1506)
Synonym: HT010; LEREPO4; MSTP012
NM_018471.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polo-like kinase 1 substrate 1 (PLK1S1), transcript variant 1, mRNA. (2329 bp)
..... cacgggctgcgggacagtgaaaagaagagattggacctggaaaagaaacttta .....
position 226 (CDS: 134 - 2155)
Synonym: C20orf19; HT013; Kiz; Kizuna; NCRNA00153
NM_018474.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 1, mRNA. (6265 bp)
..... gaagacaaagtaccactgataaagaagagattgtcaaatagatgcattcctag .....
position 5327 (CDS: 48 - 1094)
Synonym: DUBA8; OTUD2; PRO0907; RP11-164O23.1
NM_018566.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Nedd4 family interacting protein 2 (NDFIP2), transcript variant 1, mRNA. (4666 bp)
..... gcccatcttaagagatcttgcaggaagagattgtattagatattatatttatt .....
position 1980 (CDS: 81 - 1091)
Synonym: N4WBP5A
NM_019080.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens intersectin 2 (ITSN2), transcript variant 3, mRNA. (6031 bp)
..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaag .....
position 1690 (CDS: 259 - 5271)
Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_019595.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens calcium binding protein 5 (CABP5), mRNA. (1845 bp)
..... agcgggaaagaccactgggacaagatgagattgaagagctgcgggaagcattt .....
position 211 (CDS: 133 - 654)
Synonym: CABP3
NM_019855.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane 9 superfamily member 3 (TM9SF3), mRNA. (6140 bp)
..... acagcaaaaacaaacaaacgcaagaagagatttgggctttaacacactgggta .....
position 2066 (CDS: 218 - 1987)
Synonym: EP70-P-iso; RP11-34E5.1; SMBP
NM_020123.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine zipper transcription factor-like 1 (LZTFL1), transcript variant 1, mRNA. (4075 bp)
..... acaaggaaattttaagacttcaagaagagaatgagaaattgaagtcaaggttg .....
position 639 (CDS: 168 - 1067)
Synonym: BBS17
NM_020347.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger, NFX1-type containing 1 (ZNFX1), mRNA. (7371 bp)
..... gaactagcataaaacagcggctagaagagattgaaatcatcaaggaaaagatc .....
position 5165 (CDS: 248 - 6004)
NM_021035.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens MMS19 nucleotide excision repair homolog (S. cerevisiae) (MMS19), mRNA. (3703 bp)
..... ttagccaaacccctggatgacaagaagagactggtgcgcaaggaagcagtgtc .....
position 3243 (CDS: 226 - 3318)
Synonym: hMMS19; MET18; MMS19L
NM_022362.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens centromere protein H (CENPH), mRNA. (1405 bp)
..... gaaaaactgcttgatattagaaagaagagattgcaattaaaacaagcttcaga .....
position 561 (CDS: 88 - 831)
NM_022909.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 1, mRNA. (3685 bp)
..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgca .....
position 1472 (CDS: 170 - 3532)
Synonym: FAM42A; HsT19294; RIA1
NM_024580.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA. (7555 bp)
..... tcacagcctctgattttttccaagaagagattgccttcaccattgttaaatgt .....
position 5996 (CDS: 138 - 5750)
NM_024940.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens valosin containing protein (p97)/p47 complex interacting protein 1 (VCPIP1), mRNA. (8176 bp)
..... actcagcccacactgtgaaacaagaagatattgctgttactggtaaactgtca .....
position 2870 (CDS: 260 - 3928)
Synonym: DUBA3; VCIP135
NM_025054.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 186, member B (FAM186B), transcript variant 1, mRNA. (2979 bp)
..... cagcagagagatccaaagggcaagaagagattcatcttgctggaaaaaattgc .....
position 392 (CDS: 174 - 2855)
Synonym: C12orf25
NM_032130.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9), transcript variant 1, mRNA. (2727 bp)
..... tctgacgtgttttatttctccaagaagggattggaagccattgtagaagatga .....
position 606 (CDS: 307 - 1611)
Synonym: AGPAT8; GPAT3; HMFN0839; LPAAT-theta; MAG1
NM_032717.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 2, mRNA. (8865 bp)
..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaactt .....
position 778 (CDS: 79 - 2505)
Synonym: HSSOX6; SOXD
NM_033326.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 129, member A (FAM129A), mRNA. (6969 bp)
..... agagccaggtttctgaggaacaagaagagatgggagggcaaagcagcgcggcc .....
position 2814 (CDS: 231 - 3017)
Synonym: C1orf24; GIG39; NIBAN
NM_052966.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens collagen, type XII, alpha 1 (COL12A1), transcript variant short, mRNA. (8087 bp)
..... cagttaaatgcacacagagacaagaagagcttgttgcaagctgtggcaaactt .....
position 448 (CDS: 167 - 5866)
Synonym: BA209D8.1; COL12A1L; DJ234P15.1
NM_080645.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 22 (organic anion transporter), member 9 (SLC22A9), mRNA. (2327 bp)
..... cagaggggaagcacagtcgtcaagaagagagtggggtcaggatcaaaacacat .....
position 141 (CDS: 269 - 1930)
Synonym: HOAT4; OAT4; OAT7; ust3; UST3H
NM_080866.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens polycystic kidney and hepatic disease 1 (autosomal recessive) (PKHD1), transcript variant 1, mRNA. (16235 bp)
..... gcaggaatgtggagagcttccaaaaagagattgctctcagattttcctgaaaa ..... ttttcctgtgttagttcaaagaatctcttcttgcctcccattgctgattttct .....
position 13652 15267 (CDS: 277 - 12501)
Synonym: ARPKD; FCYT; TIGM1
NM_138694.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitogen-activated protein kinase 14 (MAPK14), transcript variant 2, mRNA. (4353 bp)
..... ttgtgccaccaccccttgaccaagaagagatggagtcctgagcacctggtttc .....
position 1544 (CDS: 482 - 1564)
Synonym: CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; p38; p38ALPHA; PRKM14; PRKM15; RK; SAPK2A
NM_139012.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitogen-activated protein kinase 14 (MAPK14), transcript variant 4, mRNA. (4274 bp)
..... ttgtgccaccaccccttgaccaagaagagatggagtcctgagcacctggtttc .....
position 1465 (CDS: 482 - 1405)
Synonym: CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; p38; p38ALPHA; PRKM14; PRKM15; RK; SAPK2A
NM_139014.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 15 (ADAMTS15), mRNA. (5676 bp)
..... tgtgatgggaacctgggctccaagaagagattcgacaagtgtggggtgtgtgg .....
position 1995 (CDS: 1 - 2853)
NM_139055.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens TruB pseudouridine (psi) synthase homolog 1 (E. coli) (TRUB1), mRNA. (3412 bp)
..... aaccttacgataaaataacacaagaagatattgaaggcattctacagaaattt .....
position 596 (CDS: 62 - 1111)
Synonym: PUS4
NM_139169.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens A kinase (PRKA) anchor protein 12 (AKAP12), transcript variant 2, mRNA. (8246 bp)
..... atgagaaaatagaagtccaccaagaagaggttgtggccgaagtccacgtcagc .....
position 1270 (CDS: 331 - 5385)
Synonym: AKAP250; SSeCKS
NM_144497.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger protein 480 (ZNF480), mRNA. (4742 bp)
..... ataaccccccaagattgaaccaagaagaaattgcatccctgaacagaccaata .....
position 2072 (CDS: 71 - 1678)
NM_144684.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens EF-hand domain family, member B (EFHB), mRNA. (2857 bp)
..... acttcttcaagaccagatcaaaagaagagattgcagagatattgtgtaacatt .....
position 2516 (CDS: 197 - 2698)
NM_144715.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) (GCNT2), transcript variant 3, mRNA. (4219 bp)
..... gatcatttctcattccctgaaaagaagagattgtttccccagggaagtgaaaa .....
position 196 (CDS: 231 - 1439)
Synonym: bA360O19.2; bA421M1.1; CCAT; GCNT2C; GCNT5; IGNT; II; NACGT1; NAGCT1; ULG3
NM_145655.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens intersectin 2 (ITSN2), transcript variant 2, mRNA. (4597 bp)
..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaag .....
position 1690 (CDS: 259 - 4008)
Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_147152.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9), transcript variant 3, mRNA. (12439 bp)
..... ataaattactaggagaattacaagaacagattgtgcaaaagaaccaagaaata ..... gagaagaccaggaacagctacaagaagagattaagagacttaatagacaatta .....
position 1312 5104 (CDS: 226 - 11925)
Synonym: AKAP-9; AKAP350; AKAP450; CG-NAP; HYPERION; LQT11; MU-RMS-40.16A; PPP1R45; PRKA9; YOTIAO
NM_147185.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens piwi-like RNA-mediated gene silencing 4 (PIWIL4), mRNA. (3214 bp)
..... gcatcactagatggacaatccaagaagaaattggtatactttgtgcaaatctg .....
position 2806 (CDS: 212 - 2770)
Synonym: HIWI2; MIWI2
NM_152431.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 5 (SOX5), transcript variant 2, mRNA. (4566 bp)
..... caagcaaacaacaatatcaacaacaagagattgaaataagctatgggtaaaat .....
position 2838 (CDS: 375 - 2627)
Synonym: L-SOX5
NM_152989.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 2, mRNA. (1821 bp)
..... tttccacttcctgaccgccgccagaagagattgattttctccactatcactag .....
position 1122 (CDS: 199 - 1362)
Synonym: MIP224; RPT3; S6; TBP-7; TBP7
NM_153001.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 (SVEP1), mRNA. (12356 bp)
..... gaggagacgagtacacattccaaaaagagattgaatacacttgcaatgaaggg .....
position 8891 (CDS: 338 - 11053)
Synonym: C9orf13; CCP22; POLYDOM; SEL-OB; SELOB
NM_153366.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ligand of numb-protein X 2 (LNX2), mRNA. (4804 bp)
..... gaaggaaaactagtagaactcaagcagagattgagaatgaaaatgggcccact .....
position 775 (CDS: 310 - 2382)
Synonym: PDZRN1
NM_153371.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cardiomyopathy associated 5 (CMYA5), mRNA. (12911 bp)
..... tgaatttatcagaagaagatcaagaagacattggacctttttctccagattct ..... acacatccgatgtgcctaaacaatctgttcttgtttcaaagcaccacttggag .....
position 2887 8662 (CDS: 73 - 12282)
Synonym: C5orf10; SPRYD2; TRIM76
NM_153610.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 1, mRNA. (9757 bp)
..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgc .....
position 2966 (CDS: 24 - 1892)
Synonym: NCKX4; SHEP6; SLC24A2
NM_153646.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 2, mRNA. (9773 bp)
..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgc .....
position 2982 (CDS: 97 - 1908)
Synonym: NCKX4; SHEP6; SLC24A2
NM_153647.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 3, mRNA. (9659 bp)
..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgc .....
position 2868 (CDS: 118 - 1794)
Synonym: NCKX4; SHEP6; SLC24A2
NM_153648.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cysteine-rich secretory protein 1 (CRISP1), transcript variant 2, mRNA. (1803 bp)
..... tcaccgacttgccaaatgtacaagaagagatcgttaatatacacaacgccctc .....
position 200 (CDS: 80 - 616)
Synonym: AEGL1; ARP; CRISP-1; HSCRISP1D; HSCRISP1G; HUMARP
NM_170609.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD8b molecule (CD8B), transcript variant 3, mRNA. (1125 bp)
..... cccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccaga .....
position 509 (CDS: 60 - 725)
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_172101.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD8b molecule (CD8B), transcript variant 4, mRNA. (981 bp)
..... cccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccaga .....
position 509 (CDS: 60 - 701)
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_172102.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CD8b molecule (CD8B), transcript variant 2, mRNA. (1071 bp)
..... cccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccaga .....
position 509 (CDS: 60 - 791)
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_172213.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 1 (GABRG1), mRNA. (6769 bp)
..... cttccaagatattgtattcccaagaagaaattgatttatttttaaactatcag .....
position 2078 (CDS: 153 - 1550)
NM_173536.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA. (2858 bp)
..... accagggggagagaccagaccaagaagagaatggccaagcccaaaaaccgggc .....
position 641 (CDS: 540 - 2438)
Synonym: ALEX2
NM_177949.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SRY (sex determining region Y)-box 5 (SOX5), transcript variant 3, mRNA. (3133 bp)
..... caagcaaacaacaatatcaacaacaagagattgaaataagctatgggtaaaat .....
position 1405 (CDS: 61 - 1194)
Synonym: L-SOX5
NM_178010.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SEC14 and spectrin domains 1 (SESTD1), mRNA. (10448 bp)
..... cccaggccctacagcagaaacacgaagagattgagagccagcacagtgaatgg .....
position 1096 (CDS: 151 - 2241)
Synonym: SOLO
NM_178123.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dynein, axonemal, heavy chain 12 (DNAH12), transcript variant 1, mRNA. (9542 bp)
..... gctggcttatccagaatctgcaagaagagactgggttcgagagtggcctggcc .....
position 3465 (CDS: 182 - 9460)
Synonym: DHC3; DLP12; DNAH12L; DNAH7L; DNAHC12; DNAHC3; DNHD2; HDHC3; HL-19; HL19
NM_178504.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1, mRNA. (6998 bp)
..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggcttt ..... aaaaagagattaagtgccttcaagaagagagtgtagttcagtgtgaagaactt .....
position 704 2609 (CDS: 155 - 5209)
Synonym: GCC185; RANBP2L4; REN53
NM_181453.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 3, mRNA. (3033 bp)
..... cgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagc .....
position 341 (CDS: 128 - 2158)
Synonym: CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75
NM_181500.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 2, mRNA. (3251 bp)
..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaa .....
position 2743 (CDS: 112 - 1335)
Synonym: BT2.2; BTF2
NM_181531.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 1, mRNA. (13760 bp)
..... cgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagc .....
position 219 (CDS: 39 - 4556)
Synonym: CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75
NM_181552.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane and tetratricopeptide repeat containing 3 (TMTC3), mRNA. (7203 bp)
..... gagttgctgctttaaaaagactagaagagattgaacgtattttaaatggtgaa .....
position 2930 (CDS: 221 - 2965)
Synonym: SMILE
NM_181783.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 2, mRNA. (2343 bp)
..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgc .....
position 1109 (CDS: 216 - 1865)
Synonym: MSK1; MSPK1; RLPK
NM_182398.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mitochondrial ribosomal protein S9 (MRPS9), mRNA. (1473 bp)
..... aagatccagaaactttcactcaagaagatattgacagagctattgcttacctt .....
position 369 (CDS: 69 - 1259)
Synonym: MRP-S9; RPMS9; S9mt
NM_182640.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 2, subfamily U, polypeptide 1 (CYP2U1), mRNA. (4760 bp)
..... aaggagatgaagagcatctccaagaagagatggtaaaaagatatataaataca .....
position 1729 (CDS: 84 - 1718)
Synonym: P450TEC; SPG49; SPG56
NM_183075.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dystonin (DST), transcript variant 1, mRNA. (18048 bp)
..... acatgttcaaggtattccagaaagaagagattgaacccttgcaaggtaaacag .....
position 10247 (CDS: 521 - 17014)
Synonym: BP240; BPA; BPAG1; CATX-15; CATX15; D6S1101; DMH; DT; HSAN6; MACF2
NM_183380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ring finger protein 212 (RNF212), transcript variant 2, mRNA. (2367 bp)
..... ttagaatttcaagaaaaacacaggaagagattgttagccttctatagagaaaa .....
position 370 (CDS: 101 - 799)
Synonym: ZHP3
NM_194439.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens solute carrier family 10 (sodium/bile acid cotransporter family), member 6 (SLC10A6), mRNA. (1502 bp)
..... gttgcagcatatcagacgtacaagaggagattgaagaacaaacatggaaaaaa .....
position 1081 (CDS: 149 - 1282)
Synonym: SOAT
NM_197965.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens butyrophilin, subfamily 3, member A3 (BTN3A3), transcript variant 2, mRNA. (2927 bp)
aatcaaaaaactaattcttccaaaaagagattgttattattcctcacaataac .....
position 21 (CDS: 299 - 1906)
Synonym: BTF3
NM_197974.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 1, mRNA. (3395 bp)
..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatt .....
position 1706 (CDS: 135 - 1892)
Synonym: FAM13C1
NM_198215.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Rho guanine nucleotide exchange factor (GEF) 1 (ARHGEF1), transcript variant 3, mRNA. (3137 bp)
..... ttcaagaacctggacatcaccaagaagaaattggtccacgagggcccactgac .....
position 1942 (CDS: 110 - 2749)
Synonym: GEF1; LBCL2; LSC; P115-RHOGEF; SUB1.5
NM_198977.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 178 (CCDC178), transcript variant 2, mRNA. (3353 bp)
..... gattgaaggctcagcaaattaaagaagagattgataaggatatttaccaggat .....
position 1178 (CDS: 212 - 2701)
Synonym: C18orf34
NM_198995.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Rho guanine nucleotide exchange factor (GEF) 1 (ARHGEF1), transcript variant 1, mRNA. (3261 bp)
..... ttcaagaacctggacatcaccaagaagaaattggtccacgagggcccactgac .....
position 2066 (CDS: 90 - 2873)
Synonym: GEF1; LBCL2; LSC; P115-RHOGEF; SUB1.5
NM_199002.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 2, mRNA. (3521 bp)
..... aacttgactgatgtaagtgtcaagaaaagattgacattttgttaaaacttcgt .....
position 3061 (CDS: 314 - 1285)
Synonym: AKR1C-pseudo; BABP; DD; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8
NM_205845.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens nuclear receptor subfamily 5, group A, member 2 (NR5A2), transcript variant 1, mRNA. (5094 bp)
..... taggagctctgctttcaaaacaaaaagagattgggggagtggggagggggaag .....
position 1904 (CDS: 247 - 1872)
Synonym: B1F; B1F2; CPF; FTF; FTZ-F1; FTZ-F1beta; hB1F-2; LRH-1; LRH1
NM_205860.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, beta pseudogene (LOC644936), non-coding RNA. (1456 bp)
..... aacctaacttgcactaaaaacaagatgagattggtgtgactttgttttttttg .....
position 862
NR_004845.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens actin, gamma 1 pseudogene 4 (ACTG1P4), non-coding RNA. (1988 bp)
..... ctcctccaccagtcgcaatggaagaagagattgccgtactggtgattgacaat .....
position 153
Synonym: ACTGP4
NR_024438.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transcription factor Dp-1 (TFDP1), transcript variant 2, non-coding RNA. (2412 bp)
..... gtttccttttggcctactcccaagaagatattggtaagctattgaatttagat .....
position 1302
Synonym: Dp-1; DP1; DRTF1
NR_026580.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC100130691 (LOC100130691), non-coding RNA. (5223 bp)
..... ggactatcttgcaaaaaatacaagaagatattgaaagttttcatgagtgccta .....
position 254
NR_026966.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 186, member B (FAM186B), transcript variant 2, non-coding RNA. (3106 bp)
..... cagcagagagatccaaagggcaagaagagattcatcttgctggaaaaaattgc .....
position 549
Synonym: C12orf25
NR_027450.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens long intergenic non-protein coding RNA 478 (LINC00478), transcript variant 2, non-coding RNA. (3278 bp)
..... tctcaatgtcaagatttgaacaagaagagaatggaatacacaatatggacatc .....
position 361
Synonym: C21orf34; C21orf35; FLJ38295
NR_027791.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 3, non-coding RNA. (3643 bp)
..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatt .....
position 1272
Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NR_028041.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 2, non-coding RNA. (6913 bp)
..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggcttt ..... aaaaagagattaagtgccttcaagaagagagtgtagttcagtgtgaagaactt .....
position 619 2524
Synonym: GCC185; RANBP2L4; REN53
NR_028063.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens elongation factor Tu GTP binding domain containing 1 pseudogene 1 (EFTUD1P1), non-coding RNA. (1167 bp)
..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgca .....
position 719
Synonym: FAM42B; HsT19321
NR_036652.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens bromodomain containing 2 (BRD2), transcript variant 5, non-coding RNA. (4899 bp)
..... cctctttacgtgattcaaacccagaagagattgagattgattttgaaacactc .....
position 3747
Synonym: D6S113E; FSH; FSRG1; NAT; RING3; RNF3
NR_037625.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens homeobox A10 (HOXA10), transcript variant 2, non-coding RNA. (2276 bp)
..... agaaaaaggggactcaccctcaagaagtgattggtatggtaatttaaagcaac .....
position 504
Synonym: HOX1; HOX1.8; HOX1H; PL
NR_037939.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HOXA10-HOXA9 readthrough (HOXA10-HOXA9), non-coding RNA. (2110 bp)
..... agaaaaaggggactcaccctcaagaagtgattggtatggtaatttaaagcaac .....
position 504
NR_037940.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chitinase 1 (chitotriosidase) (CHIT1), transcript variant 3, non-coding RNA. (2553 bp)
..... acagccccctctacaagaggcaagaagagagtggtgcagcagccagcctcaac .....
position 790
Synonym: CHI3; CHIT; CHITD
NR_045784.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chitinase 1 (chitotriosidase) (CHIT1), transcript variant 4, non-coding RNA. (2396 bp)
..... acagccccctctacaagaggcaagaagagagtggtgcagcagccagcctcaac .....
position 790
Synonym: CHI3; CHIT; CHITD
NR_045785.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CERS6 antisense RNA 1 (CERS6-AS1), transcript variant 1, non-coding RNA. (2992 bp)
..... aacaactattaatgcaacatcatgaagagattggggacaattgtgggtgtcta .....
position 1772
NR_045786.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens CERS6 antisense RNA 1 (CERS6-AS1), transcript variant 2, non-coding RNA. (2899 bp)
..... aacaactattaatgcaacatcatgaagagattggggacaattgtgggtgtcta .....
position 1679
NR_045787.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens microRNA 5197 (MIR5197), microRNA. (112 bp)
..... ttcttgaatttttgccagttcaagaagagactgagtcatcgaatgctctaaat .....
position 63
NR_049829.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SUZ RNA binding domain containing 1 pseudogene (LOC100130075), non-coding RNA. (1058 bp)
..... acagcgcagataaatgcaggcaagaagagatggcgcgactgccgcgtcaacgc .....
position 499
NR_073494.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine zipper transcription factor-like 1 (LZTFL1), transcript variant 4, non-coding RNA. (3950 bp)
..... acaaggaaattttaagacttcaagaagagaatgagaaattgaagtcaaggttg .....
position 514
Synonym: BBS17
NR_075080.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SPECC1L-ADORA2A readthrough (SPECC1L-ADORA2A), non-coding RNA. (6289 bp)
..... atgacattaaatctgaagcccaagaggagattggtgatctaaagcgccggtta .....
position 2610
NR_103546.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506647 (LOC100506647), misc_RNA. (3225 bp)
..... agtgtacgctcaaaccgtttcaagaagagatttaaacctcttcttggagaaga .....
position 629
XR_108679.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens KRBOX1 antisense RNA 1 (KRBOX1-AS1), misc_RNA. (2144 bp)
..... tgatgtaagacaggcactttcaagaagagatggttgtaagcacttgtttacat .....
position 1231
XR_110049.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens KRBOX1 antisense RNA 1 (KRBOX1-AS1), misc_RNA. (2144 bp)
..... tgatgtaagacaggcactttcaagaagagatggttgtaagcacttgtttacat .....
position 1231
XR_112466.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC149351 (LOC149351), misc_RNA. (2454 bp)
..... ccctggatttcgcttgggcagaagaagagattgtaggccggaccccaacgccg .....
position 294
XR_132798.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC149351 (LOC149351), misc_RNA. (2454 bp)
..... ccctggatttcgcttgggcagaagaagagattgtaggccggaccccaacgccg .....
position 294
XR_133250.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506647 (LOC100506647), misc_RNA. (3225 bp)
..... agtgtacgctcaaaccgtttcaagaagagatttaaacctcttcttggagaaga .....
position 629
XR_133418.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC149351 (LOC149351), misc_RNA. (2454 bp)
..... ccctggatttcgcttgggcagaagaagagattgtaggccggaccccaacgccg .....
position 294
XR_171172.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens KRBOX1 antisense RNA 1 (KRBOX1-AS1), misc_RNA. (2144 bp)
..... tgatgtaagacaggcactttcaagaagagatggttgtaagcacttgtttacat .....
position 1231
XR_171375.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506647 (LOC100506647), misc_RNA. (3225 bp)
..... agtgtacgctcaaaccgtttcaagaagagatttaaacctcttcttggagaaga .....
position 629
XR_171557.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC101060712 (LOC101060712), misc_RNA. (5198 bp)
..... ccaagaacagtagctataaggaagaagagattgtgcttagtggacagcattct .....
position 2299
XR_172042.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coagulation factor VIII, procoagulant component (F8), transcript variant 1, mRNA. (9048 bp)
..... aaagctttgaaataaaataacaatgtcttcttgaaatttgtgatggccaagaa .....
position 8058 (CDS: 172 - 7227)
Synonym: AHF; DXS1253E; F8B; F8C; FVIII; HEMA
NM_000132.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fibrillin 1 (FBN1), mRNA. (11695 bp)
..... tcataaatgtcacaataaaacaatctcttcttttttttagtttaccccttggc .....
position 9905 (CDS: 396 - 9011)
Synonym: ACMICD; ECTOL1; FBN; GPHYSD2; MASS; MFS1; OCTD; SGS; SSKS; WMS; WMS2
NM_000138.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 1, mRNA. (2119 bp)
..... gccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgccctt .....
position 702 (CDS: 46 - 1539)
Synonym: CP26; CYP26; P450RAI; P450RAI1
NM_000783.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens kallikrein B, plasma (Fletcher factor) 1 (KLKB1), mRNA. (2252 bp)
..... cacacgcattgttggaggaacaaactcttcttggggagagtggccctggcagg .....
position 1255 (CDS: 72 - 1988)
Synonym: KLK3; PPK
NM_000892.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), transcript variant 1, mRNA. (2604 bp)
..... tggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagaca .....
position 1661 (CDS: 844 - 1719)
Synonym: c-MIR; MARCH-VIII; MIR; RNF178
NM_001002265.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), transcript variant 3, mRNA. (2000 bp)
..... tggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagaca .....
position 1057 (CDS: 240 - 1115)
Synonym: c-MIR; MARCH-VIII; MIR; RNF178
NM_001002266.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 2, mRNA. (2150 bp)
..... atactgttctctcatggctccaagctcttcttgtcctgctgtatccaaaatat .....
position 1445 (CDS: 169 - 1137)
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_001007098.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 154, member B (FAM154B), mRNA. (3146 bp)
..... gatttttttttaaaattgctcaatctctttttgtacttgttttctccttttca .....
position 2364 (CDS: 70 - 1266)
NM_001008226.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 2, mRNA. (2674 bp)
..... ggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 815 (CDS: 348 - 2150)
Synonym: RABIP4; ZFYVE12
NM_001040451.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 3, mRNA. (2485 bp)
..... ggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 626 (CDS: 159 - 1961)
Synonym: RABIP4; ZFYVE12
NM_001040452.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-3' exoribonuclease 1 (XRN1), transcript variant 2, mRNA. (10053 bp)
..... atctcaccataagtcaacaccaatctcttcttcaagaagaaaatcaagaaaac .....
position 5079 (CDS: 68 - 5149)
Synonym: SEP1
NM_001042604.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens U2 snRNP-associated SURP domain containing (U2SURP), mRNA. (7464 bp)
..... agtcttccaatgaaagaccaccatctcttcttgtgatagaaaccaaaaaacct .....
position 637 (CDS: 100 - 3189)
Synonym: fSAPa; SR140
NM_001080415.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RB1-inducible coiled-coil 1 (RB1CC1), transcript variant 2, mRNA. (6661 bp)
..... cccagcagaaggagaccttgaaatctcttcttgaacaagagacagaaaatttg .....
position 3826 (CDS: 559 - 5334)
Synonym: CC1; FIP200
NM_001083617.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 210, member A (FAM210A), transcript variant 1, mRNA. (4392 bp)
..... aaatgaatatgctgtgattggaatctcttcttgggggccggggagagtgctga .....
position 3045 (CDS: 433 - 1251)
Synonym: C18orf19; HsT2329
NM_001098801.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens leucine rich repeat containing 58 (LRRC58), mRNA. (7683 bp)
..... aaatatctcccattctttttctatctcttcttggtctatatttactaagaatt .....
position 6777 (CDS: 97 - 1212)
NM_001099678.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Purkinje cell protein 4 like 1 (PCP4L1), mRNA. (1480 bp)
..... tcactagtctaagggtggaacaatttcttcttggtataaggttctttgatcag .....
position 679 (CDS: 249 - 455)
Synonym: IQM1
NM_001102566.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 2, mRNA. (4833 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4747 (CDS: 90 - 1757)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_001114978.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 4, mRNA. (4697 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4611 (CDS: 142 - 1902)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_001114980.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 5, mRNA. (4603 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4517 (CDS: 142 - 1527)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_001114981.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fermitin family member 2 (FERMT2), transcript variant 2, mRNA. (3372 bp)
..... tggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaa .....
position 904 (CDS: 187 - 2250)
Synonym: KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
NM_001134999.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fermitin family member 2 (FERMT2), transcript variant 3, mRNA. (2161 bp)
..... tggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaa .....
position 904 (CDS: 187 - 2088)
Synonym: KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
NM_001135000.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mucin 15, cell surface associated (MUC15), transcript variant 1, mRNA. (3409 bp)
..... tctgcaaaatgggcataatacaatctattcttgccacatcaagggattgttat .....
position 286 (CDS: 274 - 1359)
Synonym: MUC-15; PAS3; PASIII
NM_001135091.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens mucin 15, cell surface associated (MUC15), transcript variant 3, mRNA. (3259 bp)
..... tctgcaaaatgggcataatacaatctattcttgccacatcaagggattgttat .....
position 286 (CDS: 274 - 1209)
Synonym: MUC-15; PAS3; PASIII
NM_001135092.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens stonin 1 (STON1), transcript variant 1, mRNA. (5651 bp)
..... ggtgccgtcttcatttcttcccatctcttcttgctgcttagtgtctgtactag .....
position 2783 (CDS: 213 - 2420)
Synonym: SALF; SBLF; STN1; STNB1
NM_001198595.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens torsin A interacting protein 2 (TOR1AIP2), transcript variant 3, mRNA. (8331 bp)
..... aactaatttagactagagccctatctcttcttgagaagctgggatttgaagga .....
position 612 (CDS: 815 - 2227)
Synonym: IFRG15; LULL1; NET9; RP11-12M5.5
NM_001199260.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 3, mRNA. (4739 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4032 (CDS: 107 - 574)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_001204869.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 4, mRNA. (4459 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 3752 (CDS: 107 - 475)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_001204870.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptotagmin XIII (SYT13), transcript variant 2, mRNA. (5388 bp)
..... ataagctgaaagctgaccagcattctcttcttggtaacatctactactccaat .....
position 3938 (CDS: 777 - 1625)
NM_001247987.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ceramide synthase 6 (CERS6), transcript variant 1, mRNA. (6868 bp)
..... tagacacccacaattgtccccaatctcttcatgatgttgcattaatagttgtt .....
position 4869 (CDS: 201 - 1379)
Synonym: CERS5; LASS6
NM_001256126.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 2, mRNA. (5657 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4332 (CDS: 1269 - 3038)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_001256574.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 3, mRNA. (5645 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4320 (CDS: 1257 - 3026)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_001256575.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 4, mRNA. (5384 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4059 (CDS: 1215 - 2765)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_001256576.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized protein ENSP00000383407-like (LOC388813), mRNA. (892 bp)
..... gagagtgaacaaacaccaaacaatctcttcgtgggagtttctaatttagagaa .....
position 94 (CDS: 35 - 433)
NM_001256579.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 (PSMD11), transcript variant 1, mRNA. (4035 bp)
..... ctaaagcagctcgcctggtccgatctcttcttgatctgtttcttgatatggaa .....
position 329 (CDS: 62 - 1330)
Synonym: p44.5; Rpn6; S9
NM_001270482.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized LOC643355 (LOC643355), mRNA. (3036 bp)
..... tggacactaattttatataccaacctcttcttggtaaagagacatagctcatg .....
position 1686 (CDS: 330 - 707)
NM_001270945.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 (PSMD11), transcript variant 2, mRNA. (3914 bp)
..... ctaaagcagctcgcctggtccgatctcttcttgatctgtttcttgatatggaa .....
position 329 (CDS: 62 - 1330)
Synonym: p44.5; Rpn6; S9
NM_002815.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 1, mRNA. (5520 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 4195 (CDS: 1132 - 2901)
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NM_003633.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens tumor protein p63 (TP63), transcript variant 1, mRNA. (4927 bp)
..... gggagccagaagccaatctacaatctctttttgtttgccaggacatgcaataa .....
position 4841 (CDS: 90 - 2132)
Synonym: AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
NM_003722.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1, mRNA. (5194 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4487 (CDS: 107 - 1210)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_003882.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cellular retinoic acid binding protein 1 (CRABP1), mRNA. (782 bp)
..... agaacaagatccactgcacgcaaactcttcttgaaggggacggccccaaaacc .....
position 397 (CDS: 106 - 519)
Synonym: CRABP; CRABP-I; CRABPI; RBP5
NM_004378.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 (B4GALT5), mRNA. (4743 bp)
..... aaatagacataaatatataacaatcacttcttgaagaagtataattgtaaata .....
position 1951 (CDS: 195 - 1361)
Synonym: B4Gal-T5; BETA4-GALT-IV; beta4Gal-T5; beta4GalT-V; gt-V
NM_004776.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 (ARHGEF6), mRNA. (5282 bp)
..... aagaatatgctaaagaacttcagtctcttcttgttacttacttaagacccctg .....
position 1243 (CDS: 463 - 2793)
Synonym: alpha-PIX; alphaPIX; Cool-2; COOL2; MRX46; PIXA
NM_004840.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens paired-like homeobox 2a (PHOX2A), mRNA. (1716 bp)
..... cccggccccgccctgaagaccaatctcttctagctgccggcctctggaggctc .....
position 1015 (CDS: 173 - 1027)
Synonym: ARIX; CFEOM2; FEOM2; NCAM2; PMX2A
NM_005169.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens fermitin family member 2 (FERMT2), transcript variant 1, mRNA. (3351 bp)
..... tggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaa .....
position 904 (CDS: 187 - 2229)
Synonym: KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
NM_006832.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens stonin 1 (STON1), transcript variant 2, mRNA. (5534 bp)
..... ggtgccgtcttcatttcttcccatctcttcttgctgcttagtgtctgtactag .....
position 2666 (CDS: 96 - 2303)
Synonym: SALF; SBLF; STN1; STNB1
NM_006873.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens proline synthetase co-transcribed homolog (bacterial) (PROSC), mRNA. (2586 bp)
..... aacaaattgatggctgtccccaatctcttcatgctggaaacagtggattctgt .....
position 404 (CDS: 78 - 905)
NM_007198.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RAB3 GTPase activating protein subunit 2 (non-catalytic) (RAB3GAP2), mRNA. (7329 bp)
..... ttgatggatttagcctttttcaatctcttcgtgcttgtcgaaatcaggtagca .....
position 840 (CDS: 165 - 4346)
Synonym: p150; RAB3-GAP150; RAB3GAP150; RP11-568G11.1; WARBM2
NM_012414.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 2B (LCE2B), mRNA. (619 bp)
..... cccagctccatgttcccctgcagtctcttcttgctgtggtcccatctctgggg .....
position 182 (CDS: 55 - 387)
Synonym: LEP10; SPRL1B; XP5
NM_014357.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RB1-inducible coiled-coil 1 (RB1CC1), transcript variant 1, mRNA. (6670 bp)
..... cccagcagaaggagaccttgaaatctcttcttgaacaagagacagaaaatttg .....
position 3826 (CDS: 559 - 5343)
Synonym: CC1; FIP200
NM_014781.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens pannexin 1 (PANX1), mRNA. (2782 bp)
..... tacaacgatttgagcctctacaatctcttcttggaggaaaatataagtgaggt .....
position 1378 (CDS: 386 - 1666)
Synonym: MRS1; PX1; UNQ2529
NM_015368.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 6-like (ERCC6L), mRNA. (4224 bp)
..... ccacagtatgcatgtgatttcaatcttttcttggaagactcagcagacaacag .....
position 2956 (CDS: 98 - 3850)
Synonym: PICH; RAD26L
NM_017669.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens armadillo repeat containing 4 (ARMC4), mRNA. (3572 bp)
..... acctccttgttggaataaaccaagctcttcttgtgaatgttacaaaagcagtt .....
position 2524 (CDS: 94 - 3228)
Synonym: RP11-691I13.1
NM_018076.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens round spermatid basic protein 1 (RSBN1), mRNA. (6604 bp)
..... taaggtgtgaggtaacaattcaatctcttcttcaaatcaaaatgagaattctc .....
position 2702 (CDS: 37 - 2445)
Synonym: ROSBIN; RP11-324J2.1
NM_018364.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens 5'-3' exoribonuclease 1 (XRN1), transcript variant 1, mRNA. (10092 bp)
..... atctcaccataagtcaacaccaatctcttcttcaagaagaaaatcaagaaaac .....
position 5118 (CDS: 68 - 5188)
Synonym: SEP1
NM_019001.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens taste receptor, type 2, member 1 (TAS2R1), mRNA. (1355 bp)
..... attttcttcttgcagtgatacaatttcttcttgggattttcacaaatggcatc .....
position 365 (CDS: 320 - 1219)
Synonym: T2R1; TRB7
NM_019599.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coagulation factor VIII, procoagulant component (F8), transcript variant 2, mRNA. (2617 bp)
..... aaagctttgaaataaaataacaatgtcttcttgaaatttgtgatggccaagaa .....
position 1627 (CDS: 146 - 796)
Synonym: AHF; DXS1253E; F8B; F8C; FVIII; HEMA
NM_019863.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens synaptotagmin XIII (SYT13), transcript variant 1, mRNA. (5184 bp)
..... ataagctgaaagctgaccagcattctcttcttggtaacatctactactccaat .....
position 3720 (CDS: 127 - 1407)
NM_020826.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane BAX inhibitor motif containing 1 (TMBIM1), mRNA. (2375 bp)
..... gcccatgggtctccttgcttcaatcccttcttgtttcagtgacatatgtattg .....
position 1629 (CDS: 133 - 1068)
Synonym: LFG3; MST100; MSTP100; PP1201; RECS1
NM_022152.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens torsin A interacting protein 2 (TOR1AIP2), transcript variant 1, mRNA. (7074 bp)
..... aactaatttagactagagccctatctcttcttgagaagctgggatttgaagga .....
position 612 (CDS: 928 - 1323)
Synonym: IFRG15; LULL1; NET9; RP11-12M5.5
NM_022347.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens N-terminal EF-hand calcium binding protein 1 (NECAB1), mRNA. (5140 bp)
..... cctaaatgacttttgacatacaaactcttcttgagaatgtttgttgtaaatgg .....
position 2959 (CDS: 195 - 1250)
Synonym: EFCBP1; STIP-1
NM_022351.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens SH3 domain and tetratricopeptide repeats 2 (SH3TC2), mRNA. (26588 bp)
..... aaaaaaaaaaaaaaccaatgaaatctcttcttggaattatgtatacacaccca .....
position 16136 (CDS: 153 - 4019)
Synonym: CMT4C; MNMN
NM_024577.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ATPase, class V, type 10B (ATP10B), mRNA. (7582 bp)
..... tactggcagatgatattcttcaatctcttctttacctccttgcctcctcttgt .....
position 4297 (CDS: 848 - 5233)
Synonym: ATPVB
NM_025153.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens RUN and FYVE domain containing 1 (RUFY1), transcript variant 1, mRNA. (2660 bp)
..... ggactcaatgttctcgatgccaatctctgcttgaaaggagaagacttggattc .....
position 801 (CDS: 10 - 2136)
Synonym: RABIP4; ZFYVE12
NM_025158.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens coiled-coil domain containing 3 (CCDC3), mRNA. (2753 bp)
..... agggctcattccagccattccaatctcttcttctttatgcaaacacttttccc .....
position 1907 (CDS: 135 - 947)
Synonym: RP11-347I22.1
NM_031455.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens FLYWCH-type zinc finger 1 (FLYWCH1), transcript variant 1, mRNA. (5009 bp)
..... taggccaggtcaacccacaccaatctcttctggacaggtgctgggtaggcctt .....
position 2995 (CDS: 364 - 2511)
NM_032296.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ANKH inorganic pyrophosphate transport regulator (ANKH), mRNA. (8224 bp)
..... ttgtgtcctcctcccctggacaatctcctcttggaaccaaaggactgcagctg .....
position 2122 (CDS: 332 - 1810)
Synonym: ANK; CCAL2; CMDJ; CPPDD; HANK; MANK
NM_054027.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 2, mRNA. (2245 bp)
..... gccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgccctt .....
position 828 (CDS: 379 - 1665)
Synonym: CP26; CYP26; P450RAI; P450RAI1
NM_057157.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 2, mRNA. (4933 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 4226 (CDS: 107 - 949)
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NM_080838.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), transcript variant 2, mRNA. (2511 bp)
..... tggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagaca .....
position 1568 (CDS: 751 - 1626)
Synonym: c-MIR; MARCH-VIII; MIR; RNF178
NM_145021.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens chromosome 7 open reading frame 33 (C7orf33), mRNA. (1374 bp)
..... ctaaatttgtgtagattgtgaaatctcttcttgcaagaaaaaagagaaatagc .....
position 945 (CDS: 362 - 895)
NM_145304.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens family with sequence similarity 210, member A (FAM210A), transcript variant 2, mRNA. (4252 bp)
..... aaatgaatatgctgtgattggaatctcttcttgggggccggggagagtgctga .....
position 2905 (CDS: 293 - 1111)
Synonym: C18orf19; HsT2329
NM_152352.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 4A (LCE4A), mRNA. (388 bp)
..... tgcatcctcatgcccacctccaatctcttcctgctgtggctccagctctgggg .....
position 136 (CDS: 30 - 329)
Synonym: LEP8; SPRL4A
NM_178356.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens late cornified envelope 2C (LCE2C), mRNA. (594 bp)
..... cccagctccatgtttccctgcagtctcttcttgctgtggtcccagctctggga .....
position 163 (CDS: 36 - 368)
Synonym: LEP11
NM_178429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ceramide synthase 6 (CERS6), transcript variant 2, mRNA. (6844 bp)
..... tagacacccacaattgtccccaatctcttcatgatgttgcattaatagttgtt .....
position 4845 (CDS: 201 - 1355)
Synonym: CERS5; LASS6
NM_203463.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens methyltransferase like 10 (METTL10), mRNA. (2638 bp)
..... attaagtaattgagtcctttcaatgtcttcttgaggtatgtattgcttgttct .....
position 1702 (CDS: 38 - 913)
Synonym: C10orf138; Em:AC068896.3
NM_212554.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens HOXA11 antisense RNA (HOXA11-AS), antisense RNA. (1628 bp)
..... gagaagggagggagccggctcagtctcttcttgtttttccaaacttcaaggtc .....
position 1211
Synonym: HOXA-AS5; HOXA11-AS1; HOXA11AS; HOXA11S; NCRNA00076
NR_002795.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ankyrin repeat domain 57 pseudogene (LOC389834), non-coding RNA. (8205 bp)
..... gctaaatcttctcaattttccaatcttttcttgaatctattagatacctatag .....
position 4180
NR_027420.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens OTX2 antisense RNA 1 (head to head) (OTX2-AS1), non-coding RNA. (2440 bp)
..... agaacatgctctttatcttccagtctcttcttgtcaatttggaaattgcagac .....
position 243
Synonym: OTX2OS1
NR_029385.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens STXBP5 antisense RNA 1 (STXBP5-AS1), non-coding RNA. (3082 bp)
..... taatggcagcgtccccacctaaatctcttcttgaattgtagttcccataatcc .....
position 1427
NR_034115.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 5, non-coding RNA. (4653 bp)
..... aggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctg .....
position 3946
Synonym: CCN4; WISP1c; WISP1i; WISP1tc
NR_037944.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant G, non-coding RNA. (3218 bp)
..... gcttttctaagttactctttcaagctcttcttgcgatagaaatgaaatgaaca .....
position 288
Synonym: DFNB10; DFNB8; ECHOS1; TADG12
NR_046020.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uncharacterized protein MGC27345 (MGC27345), non-coding RNA. (10079 bp)
..... tcctcctgggaactgcataacaaactcttcttgcagagatagttttctctgtg .....
position 8660
NR_046216.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ectodermal-neural cortex 1 (with BTB domain) (ENC1), transcript variant 5, non-coding RNA. (3705 bp)
..... agatttactgggcctgaactcattctcttcttgctatatgatttagcaagttc .....
position 2380
Synonym: CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
NR_046318.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC101059976 (LOC101059976), mRNA. (2424 bp)
..... gagccgagctcacgcgcccccaatcgcttcttgcccgcggactcgggcccaac .....
position 388 (CDS: 1 - 1149)
XM_003959913.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC101059976 (LOC101059976), mRNA. (2424 bp)
..... gagccgagctcacgcgcccccaatcgcttcttgcccgcggactcgggcccaac .....
position 388 (CDS: 1 - 1149)
XM_003960274.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens late cornified envelope 4A (LCE4A), mRNA. (684 bp)
..... tgcatcctcatgcccacctccaatctcttcctgctgtggctccagctctgggg .....
position 357 (CDS: 41 - 568)
XM_003960896.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128909 (LOC100128909), misc_RNA. (677 bp)
..... atattcaagcaagttcaatccaatctcttcctgactcactgtctcatcaacat .....
position 385
XR_108975.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2261 bp)
..... aaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2016
XR_109667.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506157 (LOC100506157), misc_RNA. (580 bp)
..... atctcttttgcattgttttccaatctgttcttggttgccattgtatagaaaca .....
position 400
XR_110279.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2260 bp)
..... aaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2015
XR_112184.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128909 (LOC100128909), misc_RNA. (677 bp)
..... atattcaagcaagttcaatccaatctcttcctgactcactgtctcatcaacat .....
position 385
XR_113235.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens putative transcript Y 11 protein-like (LOC100652931), miscRNA. (663 bp)
..... aggtcctacacgtagacggccaatctcttcctggagaaatgaccacatgtctc .....
position 122
XR_132690.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506157 (LOC100506157), misc_RNA. (580 bp)
..... atctcttttgcattgttttccaatctgttcttggttgccattgtatagaaaca .....
position 400
XR_133038.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens RNA-binding motif protein, Y chromosome, family 1 member F/J-like (LOC100996822), misc_RNA. (1149 bp)
..... aggtcctccatgcagagagccaatctcttcctggagaaatgaccgtatgtcac .....
position 596
XR_159531.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100128909 (LOC100128909), misc_RNA. (677 bp)
..... atattcaagcaagttcaatccaatctcttcctgactcactgtctcatcaacat .....
position 385
XR_171795.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens uncharacterized LOC100506157 (LOC100506157), misc_RNA. (580 bp)
..... atctcttttgcattgttttccaatctgttcttggttgccattgtatagaaaca .....
position 400
XR_172037.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
PREDICTED: Homo sapiens long intergenic non-protein coding RNA 650 (LINC00650), misc_RNA. (2265 bp)
..... aaaatgatttggtttatggtctatctcttcttgctagaatgtgagctctacaa .....
position 2016
XR_172343.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.013 | 0.013 | q_start
0.238 | 0.225 | q_end
2.613 | 2.375 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.