GGRNA Home | Help | Advanced search

2020-09-20 17:42:31, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:hits:results:
seq:GCATGGGATGGGACAGTCTGGGCCA1 NM_032753
seq:AGAAGTGCGGCACCAGGGCAGGAGC1 NM_032753
seq:GGCAGGAGCTGCAGTAGCTACCCTC1 NM_032753
seq:AGATCACTCCCAGATCACCAGGTCA1 NM_032753
seq:AGGTCACCCCATCTCTAGGCGGCAC1 NM_032753
seq:AATGTCACCGCACACCAGGCAGTGG1 NM_032753
seq:GGGACACGGCAGTAAGCACAAGAAA1 NM_032753
seq:ACGGCAGTAAGCACAAGAAAGATTT1 NM_032753
seq:TCTCCACAAACGTTTTTAAAATGTG1 NM_032753
seq:AAAATGTGCCGGGTGTACTGGTGCA1 NM_032753
seq:ATGTGCCGGGTGTACTGGTGCACAC1 NM_032753
[AND] 1 NM_032753

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), mRNA. (2190 bp)
..... cagcaggagggggccctgaggcatgggatgggacagtctgggccagcgccacctcccgggacagaagtgcggcaccagggcaggagctgcagtagctaccctccccgtctccagcctgggctccccagatcactcccagatcaccaggtcaccccatctctaggcggcacctcacacaccagtcctgtgg ..... ccaacgccccgccatcacccaatgtcaccgcacaccaggcagtggggacacggcagtaagcacaagaaagatttttttttttaaagctaaacca ..... ggtgacacagcaagaccccatctccacaaacgtttttaaaatgtgccgggtgtactggtgcacacctgtcatcccagctacccaa .....
position 1592 1634 1650 1698 1717 1783 1807 1812 1955 1972 1975 (CDS: 69 - 623)
Synonym: ARMD6; CORD11; QRX; RAXL1
NM_032753.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.162 | 0.162 | q_start
0.238 | 0.076 | q_start
0.244 | 0.006 | q_start
0.252 | 0.008 | q_start
0.259 | 0.007 | q_start
0.265 | 0.006 | q_start
0.272 | 0.007 | q_start
0.278 | 0.006 | q_start
0.283 | 0.005 | q_start
0.289 | 0.006 | q_start
0.295 | 0.006 | q_start
0.301 | 0.006 | q_end
0.302 | 0.001 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.