GGRNA Home | Help | Advanced search

2020-10-26 19:32:13, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_042978               7444 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens FERM and PDZ domain containing 3 (FRMPD3),
            mRNA.
ACCESSION   XM_042978
VERSION     XM_042978.7  GI:341915927
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NT_011651) annotated using gene prediction method: GNOMON,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 28, 2011 this sequence version replaced gi:113430011.
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7444
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
     gene            1..7444
                     /gene="FRMPD3"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 2 mRNAs, 5 ESTs, 1 Protein"
                     /db_xref="GeneID:84443"
                     /db_xref="HGNC:29382"
     CDS             1..5568
                     /gene="FRMPD3"
                     /codon_start=1
                     /product="FERM and PDZ domain-containing protein 3"
                     /protein_id="XP_042978.6"
                     /db_xref="GI:341915928"
                     /db_xref="GeneID:84443"
                     /db_xref="HGNC:29382"
                     /translation="
METLDSQRVQDRLLAAPGCSSPSGQQELFSSHVMQEESANDMECEQLPAEILRQVTVHRDPIYGFGFVAGSERPVVVRSVRPVSEKLFSKKIFAKHQKQHSLVVSLYPHPLPQPRRYSPQIGGPSENKLLAGDQIVAINEEDLSIAFPYPPPSTLCYHTNMRSAKEFIVLTVLHTHQSPKSAFISAAKKAKLRSNPVKVRFSEQVAVGETDAKMMKKEALLLIPNVLKVFLENGQIKSFTFDGRTTVKDVMLTLQDRLSLRFIEHFALVLEYAGPEQNHKFLLLQDKQPLAYVVQRTHYHGMKCLFRISFFPKDPVELLRRDPAAFEYLYIQSRNDVIRERFGMDPKPEMLLGLAALHIYITVSATRPSQKISLKNVEKEWGLEPFLPPSLLQVIKEKNLRKSLSQQLKAHQTHPSCGTKGSAIQAKLQYLRILNELPTFTGVLFNTVGLDEKQSATTLLVGPRHGISHVIDLKTNLTTVLSEFSKISKIQLFRENQGVARVETSIMDAKPLVLLMEWPEATNFACLIAGYCRLLLDSRKMVFSRPASQPLPPPMIKADYMHSAHRPVTGGHLGKKESSYVGSVGTSPRKSSRCTPPPADSELVSFCYLHMREQRKEQESRTDVNENLIFFEETRPRTKSDPTSKSSGQGYEVVPDDFDAASLDHEPCASRARSYTLDNSLGAEALNFYCDSCKAKLQEQLGPRKGGKPGSSRDNIVDLMSLPPPGSEEEEEEEDETTSLLPAIAAPPPGFRDNSSDEDDPKRRAVQSQEQGRHLRGLLYDEIPVTLIDSVQTRTVRDHAQELDDALVSTLQALEALAASEDGPHPPPPQTAGLIVLATITPESSLDSGHETNSSELTDMSEMMSAMKQHQNTTYFLAQHLNKDSLLARKDLPFRIQSCAAQAVLTAPYSLGRPDPNPSLQPIATGQSPGPPGARRKLPQSEGQVQGERTYSLAVHPALSPQLSEQKNLSLLSPVPEDKGPGHTRAGLEMSLRAATSSLSEEQVSELRDNLPKEVRLSPKLILDPKSSVTPAIISAALQQVVHNKSLVTAGGALGNPPSRGERRLEASMGRPEVSMMSSSASKNLKFKISPSAPETSWNSQHQLGAEVSSSPRAPTGSRADSLHLSQQEDSLPVQNFPPKSYLLRTSRESVGKQATGEVAGKGGPVGGKPTLQKQGTISSQGEKAQLESTPKRSKLEETSLVPRATYPMALQSPSCQSRSHSPSCQPHGHSPSSQSRGQSPSCQPRGQSPLRSQAASRQVSTMPSRKLETTLNGAHSTSEGPAKPKSSRGPFRLRNLFSATFPTRQKKETDERQAQLQKVKQYELEFLEELLKPPSQGELPGTEYLQPPAPGRCSCQLRSSPVQQGPGMSREQRRSCDCKRICRGGRPQATQTPVPSLRGRERDRVLPSQRQPEAGPGVSLSSPINVQRIRSTSLESRECRSDPESGVSCLTTCASGGECLGAPNYRKLMRRYSISELDQGDRASLTSDVYPHPPLGMLPREAKEVEASLPIALGPKSRSLESPTLGDPSYVQVAPETKGPRQMAVFSLPEEVYRKPAELDEDSESSKCCSIRYCFYYRKCDMADDASDGKDELSYSIPMKILPGMKLDEQVVPVVSRTLQVLDAATCSSSSPEASRTQEIDLRVSTFEGSLAKINALRAHAYGLPDGFLAARLDTNELLTVLRQCVASPEARAPKPYVSQISEYKLELALKFKELRASCRRVANVDKSPTHMLAAITGSFQVLSSLIETFVRLVFIVRSEAQRQELLAKVEEVVRNYTFLLRAAEESTARNLNQQQQQQQQQQQQQQQQQQQQQQQQQQQVAAAAGAATEHPPGSPTSATVMSTFTHSLKTLIK
"
     misc_feature    676..1320
                     /gene="FRMPD3"
                     /note="Band 4.1 homologues; Region: B41; smart00295"
                     /db_xref="CDD:197635"
     misc_feature    961..1335
                     /gene="FRMPD3"
                     /note="FERM central domain; Region: FERM_M; pfam00373"
                     /db_xref="CDD:201187"
     variation       21
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187533209"
     variation       131
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113670695"
     variation       157
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373289807"
     variation       201
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372670453"
     variation       347
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376095202"
     variation       426
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369867915"
     variation       523
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372402075"
     variation       524
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183796305"
     variation       559
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189007704"
     variation       620
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138678310"
     variation       641
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373834655"
     variation       660
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377624026"
     variation       804
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12011630"
     variation       815
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370141752"
     variation       819
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191708698"
     variation       852
                     /gene="FRMPD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183804242"
     variation       1002
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192530115"
     variation       1068
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184794832"
     variation       1093
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367757395"
     variation       1118
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371546452"
     variation       1119
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200404965"
     variation       1243
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370170857"
     variation       1323
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137932679"
     variation       1349
                     /gene="FRMPD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376425208"
     variation       1377
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370791419"
     variation       1600
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34409749"
     variation       1689
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186977626"
     variation       1733
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371411843"
     variation       1737
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374674303"
     variation       1772
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191464475"
     variation       1810
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372050912"
     variation       1857
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370166755"
     variation       1910
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373975442"
     variation       1944
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369440568"
     variation       1956
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368170440"
     variation       1974
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372982632"
     variation       2018
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371922832"
     variation       2110
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375326152"
     variation       2193
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61184704"
     variation       2288
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181913680"
     variation       2300
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:111382527"
     variation       2328
                     /gene="FRMPD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377242352"
     variation       2379
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368777146"
     variation       2430
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145396655"
     variation       2497
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371835150"
     variation       2508
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372062988"
     variation       2610
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369613160"
     variation       2794
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185843306"
     variation       2800
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191059172"
     variation       2804
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376522247"
     variation       2826
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199655203"
     variation       2955
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181763252"
     variation       2960
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370132530"
     variation       3033
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186103884"
     variation       3060
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373805434"
     variation       3131
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190679656"
     variation       3169
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200539181"
     variation       3185
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370622567"
     variation       3231
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374045884"
     variation       3362
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368183217"
     variation       3387
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372120953"
     variation       3430
                     /gene="FRMPD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202060665"
     variation       3532
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368156988"
     variation       3554
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368612181"
     variation       3555
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371578570"
     variation       3558
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183335708"
     variation       3726
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376036356"
     variation       3735
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188122545"
     variation       3860
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371957266"
     variation       3877
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375298972"
     variation       3878
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369738439"
     variation       3883
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373259744"
     variation       3884
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376386766"
     variation       3960
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369941771"
     variation       4028
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373481868"
     variation       4100
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148049673"
     variation       4126..4127
                     /gene="FRMPD3"
                     /replace="ag"
                     /replace="cc"
                     /db_xref="dbSNP:34637928"
     variation       4146
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190160063"
     variation       4173
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376909950"
     variation       4195
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370214613"
     variation       4200
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373240414"
     variation       4236
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372464381"
     variation       4302
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183198624"
     variation       4310
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187380964"
     variation       4368
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370910242"
     variation       4374
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375806865"
     variation       4375
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368320134"
     variation       4493
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192528349"
     variation       4506
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377184517"
     variation       4574
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371181317"
     variation       4604
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376134061"
     variation       4635
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367580716"
     variation       4674
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371522221"
     variation       4678
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376108129"
     variation       4683
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368141801"
     variation       4689
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371873767"
     variation       4785
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41305439"
     variation       4821
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369848619"
     variation       4828
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369595159"
     variation       4909
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373286272"
     variation       5052
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111780917"
     variation       5110
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375881611"
     variation       5161
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369146286"
     variation       5165
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372678985"
     variation       5180
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185438129"
     variation       5229
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377153221"
     variation       5257
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370528952"
     variation       5275
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373878659"
     variation       5280
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377611123"
     STS             5361..5531
                     /gene="FRMPD3"
                     /standard_name="STS-X85323"
                     /db_xref="UniSTS:57076"
     variation       5401
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200957790"
     variation       5424..5425
                     /gene="FRMPD3"
                     /replace=""
                     /replace="cag"
                     /db_xref="dbSNP:201186557"
     variation       5424
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367997323"
     variation       5442
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41304446"
     variation       5516
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630117"
     variation       5517
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141655380"
     variation       5585
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370956101"
     variation       5710
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372443892"
     variation       5725
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144482384"
     variation       5899
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147989329"
     variation       5954
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192448417"
     variation       5976
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375830453"
     variation       5997
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41305437"
     variation       6076
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189768564"
     variation       6079
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12006998"
     variation       6150
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374998974"
     variation       6163
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41304066"
     variation       6164
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191632637"
     variation       6379
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113467896"
     variation       6412
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12558186"
     variation       6494
                     /gene="FRMPD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73638944"
     variation       6794
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188765810"
     variation       6820
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181956371"
     variation       6876
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373093913"
     variation       7076
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187058617"
     variation       7086
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190577881"
     variation       7148
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141022455"
     variation       7158
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:180987693"
     variation       7229
                     /gene="FRMPD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144882078"
     variation       7302
                     /gene="FRMPD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186074680"
ORIGIN      
atggagactctggatagccagagggtccaggaccgcctgctggcagccccaggatgcagctccccttctggccaacaggaactcttttccagtcatgtgatgcaggaagagagcgcaaatgatatggaatgtgagcagctgccagcagagatactgcgacaagtgaccgttcaccgagaccctatatatggctttggcttcgtggctggcagtgagaggcctgtggtggttcgatctgtgaggccagtctctgagaagcttttctccaagaagatctttgctaaacatcagaagcagcatagccttgtggtatccctctaccctcaccctttgccccaaccaagaaggtacagccctcagataggaggcccctctgagaacaagctcctggctggtgaccagattgtggctattaatgaggaagacttgtctattgcatttccctaccctccaccctccaccctctgctaccacaccaatatgaggagcgctaaggaattcatcgttcttacagttctgcacactcatcagtcccccaaatctgctttcatcagtgctgcgaagaaggccaagttgaggtccaatcctgtgaaggttcgattttctgagcaggtggcagttggagaaacagatgcaaaaatgatgaagaaggaagctctcctcctcatccctaatgtcctgaaggttttcttagaaaatgggcagatcaagtcattcacatttgatggtcggaccactgttaaggatgtgatgttgacattacaggaccgcctttccctgaggttcattgagcactttgctcttgtccttgagtatgccgggccagaacagaatcacaagtttctgcttcttcaggacaagcaacccctggcttatgtggtacagcggacacactatcatggaatgaaatgcctcttccgaataagcttctttcccaaagaccctgtggagctgctgcgtcgggatcctgctgcttttgagtacctatacatccagagtcggaatgatgttattcgagaacgctttggaatggatcccaagccagagatgcttttgggccttgctgcgctccacatctatatcactgtctcagccactcgacctagtcagaagatctcgctcaagaatgtggagaaggagtggggcctggaaccctttcttcccccctccctcctgcaggtcatcaaagagaagaacctccggaaatctctctctcagcaactgaaggctcaccaaacacatccttcctgcggcaccaagggctctgcaattcaggcaaagctccagtatctacgaattctgaatgaacttcctaccttcacgggcgttttgttcaacactgtaggcctggatgagaagcagtcggccaccacgctcctggtgggaccccgtcatggcatcagccatgttattgacctcaaaaccaacctcaccactgtgctgtccgagttcagcaagatcagcaagatccagctgttccgggagaaccagggcgtggcccgggtggagaccagcatcatggatgccaagcctctggtgctgttgatggagtggcctgaagccaccaactttgcctgcctgatcgcggggtactgccgcctcttgctggattccaggaagatggtcttctccaggcctgccagccagccacttccacctccaatgatcaaggcagattacatgcacagcgcccaccgccctgtcactgggggccacctggggaaaaaggagagtagttatgtgggcagcgtgggcaccagccccaggaaatcgagccgctgcacgcccccacctgccgactctgagcttgtcagcttctgctacctccatatgcgggaacaaaggaaggagcaggaaagccggacagatgtcaacgagaacctaatcttctttgaggagaccaggccccgaaccaagtctgaccccacatccaaaagctctggccaaggttatgaggtagtccctgatgactttgatgcagctagcctagaccacgagccttgtgccagcagggcccggtcctacaccttggacaattcccttggggctgaagccctgaatttctactgtgactcttgcaaagccaaacttcaggagcagctgggccctcgcaaaggtgggaagcctggctcctctcgtgacaatatagtagatttgatgtccctcccaccacctgggagtgaggaggaggaggaggaggaagatgagacaacttctctgttgccagccattgctgccccaccccctggtttccgagacaacagctctgatgaggatgaccccaagcgccgggctgtccagagccaggaacaaggacgccacctgcgtgggcttctgtacgatgagattccagtgacattgattgacagtgtgcagacccggacagttcgagatcatgcccaggagctagatgatgccctggtgtccactctgcaggctctagaagccctggctgcatccgaggatggaccacacccaccacccccacagactgcaggtctgattgtgctggccacaatcactcctgaatcatcgctggactcaggtcatgaaaccaactcttcagagctcacagacatgtcagagatgatgtcggccatgaagcagcaccagaacaccacctacttcctggcccagcacctcaacaaggacagcctccttgcccgcaaggacctgcccttccggatccagagctgtgcagcccaggccgttcttacggccccttactctcttgggcgcccggatcccaacccatctctccaacccattgccacaggccagagtcctggcccccctggcgctcggaggaagctgccccagtcagagggccaggtacagggagaacgaacatactccttggcagtgcacccagcactgtccccacagcttagtgaacagaagaatctgagtctgctgtccccagttcctgaggacaaagggcctggccacactagggcaggcctagaaatgtcactgagggcagccacatcatccctcagtgaagagcaggtctctgagctgagggacaacctgcccaaggaggtcaggttgagccccaagcttatcctcgacccaaagagcagtgtgacccctgccatcatctcggccgccctacagcaagtggttcacaataagagtctagtcactgctggtggggctttggggaacccccccagcaggggtgagagaaggctggaggccagcatggggaggccagaggttagcatgatgagcagcagtgccagtaagaatctgaagttcaaaattagccccagtgctccagagacctcatggaattctcaacatcagctgggtgcagaggtctcttccagccccagagcacccacaggcagccgggctgacagcctgcacctctcccaacaagaggacagtctgcctgttcaaaatttccctcccaaaagctatcttttgcgaacaagccgagagtcagtgggcaagcaagctacaggggaggtggcaggcaaaggcgggccagtgggtggtaagcccaccctgcagaagcagggcaccatctccagccaaggggagaaggcgcagctggagagcacacccaaaagaagcaagctcgaagagaccagcctggttccccgagctacctaccccatggctctgcagagccccagctgccagtcaagaagccacagccccagctgccagcctcatggccacagccccagcagccagtctcgaggtcagagccccagctgccaacctcgaggccagagcccactgaggtctcaggctgccagccggcaggtgagcaccatgccctctaggaagcttgaaacaactctcaatggagcccactcgacctctgaaggccctgccaaacccaagtcatcccgaggtcctttccggctacgcaatttattctctgccaccttcccaacccgccagaagaaggagacagatgagcggcaggcccaactgcagaaggtaaagcagtatgaactggagttccttgaggaacttctaaagccaccaagccagggggagctgccaggcaccgagtacctgcaacctccagcacctggccgctgcagctgccagctccgcagcagccctgtgcagcaggggcctggcatgtcccgtgagcagaggcgcagctgtgactgcaagcgcatctgccgggggggccggccacaagccacccagacaccagtgcccagcctccgggggagggaaagggacagagtcctccctagccagaggcagccagaggctggcccaggcgtgagcctcagcagccccatcaatgtccagcgcattcgttctaccagcctggagtcccgagagtgccgatcggaccctgagagtggtgtttcgtgcctgaccacgtgtgcctcggggggcgagtgtctgggagctcccaattacaggaaactgatgcgccgctacagtatcagtgagctggaccagggtgacagggcctcgctgacctcggatgtctacccacatcctcccctgggcatgctgcccagggaggccaaggaggtagaggcaagcctccccatagccttgggtcccaaaagcaggtctctggagtcaccgacgctgggagacccctcctacgtccaggttgccccagagaccaaaggccccagacagatggccgtgttctcactgcccgaggaggtgtaccggaagcctgccgagctagacgaggacagtgagagcagcaagtgctgctccatccgctactgcttctactaccgcaagtgtgacatggcagatgatgccagtgatggcaaggatgagctctcctactctatccccatgaagatcctgcctggcatgaagctggacgagcaggtggtgcctgtggtgagcaggaccctgcaggtgctggatgctgctacctgcagcagcagcagccctgaggcctcccgcactcaggagattgacctccgtgtgtccaccttcgaggggagcctggccaagatcaatgccctgcgggcccatgcctatggcctccctgatggcttcctggctgcccggctggacaccaacgagctgctgacagtcctgcggcagtgtgtggccagccccgaggcccgtgcccccaagccctatgtgtctcagatctccgagtataagcttgagctagctctcaagttcaaggagctccgggcctcctgccgccgtgtggccaatgtggacaagagcccaactcacatgctggcagccatcacgggcagcttccaggtgctgagcagcctcattgagaccttcgtgcggctggtgttcattgtgcgctccgaggcccagcgccaagagctgctggccaaggtagaagaggtggtgaggaactacaccttcctgctgcgtgcagctgaggagtccacagcccgtaaccttaaccagcagcagcagcaacaacaacagcagcagcagcaacaacaacagcagcagcaacaacaacagcagcagcagcagcagcaggtggcagcagctgcaggggcagccacagagcatccaccaggctccccaacttcggcgactgttatgagcacattcacccactccttaaaaacccttattaagtagggcatctgcccacacctgtcccccttccccaaccatggccccaggtttgagctttgtggtccttgcatcttgtggtgagtgtgtgtgtgtctgctgggccagtcagggtccaagagcccatcagtctccggggagtggaaactctcttgattgaggctctctcttaagggctgcaggcttagctgccgccctgggtgtcctcaccccttccctggcctctgggcctcactgtgagggcaaaggcccctcttcactctgctcacagcagagctgtattttatctcttctctggggctgagaggtgacatcaggctcacttcctgctcaatccgtgttgggcgctgggggagccagggcctgaagcaagcggaccctcaggctttgagctcctcgtggcatcggctcccctgctgggagcagtggcagtagcagcaggccacattgccgtgccgaggggagagggcgctcagtccagatgtccccatccaccttgggctcacactcacctggtagatgccaccctgagggcctgtgcctgggtgagatgtctgcagaaaacagccacactaggctgtttgcagcggcccaactggccggcagcctggtgagccctcacctccaggtccagtagctccacaccagccatccccaaagtgccctgcccctcactgatgggcagggcagctcagtccactagggagcaagcatctgggatcaccccactcattttgggtaaggtacctgatgaaaacgtctgcctggggagacccagtgcaggcctaggagcccgcctagcccggcccagcccagctcaggggctgttgctgcaggcatgaggcttctctctcaacatctctctaccagacagactgtccttgggagtttgacttagctgtggatcggggaggggggtggggggaggggggaaaggggtaggggtggggggtgttgatgactatatcttaaacttctggaagctagcgtgatatgttaatcctgagtatatgcttttggctgtgtattgaccctgtggatttgtctctctaagaaaagaagctgagcgccttacccggtgcagtcctgcacctttctccctctctggagccatctggaagggaattcacactgtttaacatccaccttgacacacacctcctattgccaccaccgctgccaccaccaccgccaccaccgctgccaaccctccccccacgccccccacccccgcaaccttcctgggagtgaagacacggagtccctaccaactgtcccactgtagggaacaaagaaagccaatgtttcttctgtatagattgcttctcgtccgcctctccatatctccccatttcccacacccttgtgccctgtgtctgcctctgtttcatcactgtgtcagaggcccatgtgaaatctttcattctgatgtgagttttataaagatgtacactgtgcttaatccctgcccatccttggtagcccctagtgcaataaagtctccctgagtggtgagttctcccggcaaggaggaggggagtttcttctgcagaatccagcccctcacttccttgcttctcctcccccaggaccaagttgttgaatgggccagagatgcagccagtggggaatccttttcccctcagccactgcaagctggagtgctgatatggtcttctttttctcccaacttcgccactcagcccctgcctgtgtcattccaccgccatccttcacctctccctcagcctcatggagaggaaacattttctaatgtctgtatatagtatatatactacataaaatatataaattatatatatactaatttatgtcttgtttttcaaacaagaatgattaaatctattcatcttactatccc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84443 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.