GGRNA Home | Help | Advanced search

2020-10-24 07:11:00, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_003960938            1197 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens putative IQ and AAA domain-containing
            protein 1-like (LOC101060029), mRNA.
ACCESSION   XM_003960938
VERSION     XM_003960938.1  GI:410170188
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_001839088) annotated using gene prediction method: GNOMON,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1197
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /sex="male"
                     /dev_stage="adult"
     gene            1..1197
                     /gene="LOC101060029"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 1 EST"
                     /db_xref="GeneID:101060029"
     CDS             43..1197
                     /gene="LOC101060029"
                     /codon_start=1
                     /product="putative IQ and AAA domain-containing protein
                     1-like"
                     /protein_id="XP_003960987.1"
                     /db_xref="GI:410170189"
                     /db_xref="GeneID:101060029"
                     /translation="
MSEGAYQRLWESSHATLQELLDQEQLLLEPAPDRERQSFQYRLASLYLHYLGLLRRFDTVYDQMVQPQKRRLLRRLLDGVAGRVLELKDELVRADLCENHCLDRVLQDLKLTPADLEVPIPKYFLLEQSTTVRERGLILAEILSRLEPVSSQKSFTGMHRTEAIILVQKAERARQGRLRATFMREIRRDEEQDGRIREDGWHKFSQGQAAVTIQKVWKGYLQRKRTQQDRRMEMEFIGMLPSPNQVEHLSIISQPCLVEDVQRLRQMEKEEEFRAAMVKAHDSLVETEGPDMKEKMKEQIRQWFIECQCVFRWILLNLCRQNARTDTWKNRCESIHPSQNYDSETLREEKRKEVELEIRIQVDELMRQELRKLRLAVDKEEKDP
"
     variation       367
                     /gene="LOC101060029"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:310583"
     variation       1030
                     /gene="LOC101060029"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:310586"
     variation       1185
                     /gene="LOC101060029"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201651361"
     variation       1186
                     /gene="LOC101060029"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75737896"
ORIGIN      
ccaccaccagcaaacaaggggcagcgtggaggagtggacacaatgtctgagggagcttaccagcgcctctgggagtcctcccacgcgaccctgcaggagctgctggaccaagagcagcttctgctcgaacctgcgcccgaccgggagcggcagtccttccagtacaggctcgcatcgctctacctgcactacctggggctgctgcgccgcttcgacaccgtctatgaccagatggtgcagccgcagaagcggcggctgctgcgacgcctgctggacggcgtggcgggccgcgtgctggagctcaaggacgagctggtgcgcgccgacctgtgtgagaaccactgcctggaccgcgtgctgcaggatctcaagctcaccccagctgacctggaggttccaatccccaaatacttcctgctggagcagtccaccactgtgcgggagcgagggctgatactggccgagatcctgtccagactggagccagtgtcctcccagaagagctttacaggaatgcaccggactgaggccataattctagtgcaaaaggcagagcgggcgaggcaaggccggcttcgagccaccttcatgcgagagattcgaagagatgaggagcaggatgggaggattcgggaggatggatggcacaagttcagtcagggccaagcagctgtcaccatacagaaggtgtggaaaggctatctgcagaggaaacgcactcagcaggaccggcgaatggagatggagttcattggcatgctcccctcacccaaccaggtagagcacctgagcatcatctcccagccatgcctcgtggaggatgtccagaggctccgccagatggagaaagaggaggagttccgggcagcaatggtgaaggcccatgattctctggtagagacagaggggcctgacatgaaggagaaaatgaaggagcaaatccgacagtggtttatcgagtgccaatgcgtcttcaggtggatcctactcaatctttgcagacaaaacgccagaacagatacatggaagaaccggtgtgagagcatacaccccagtcagaattatgactccgagaccctccgggaggagaagaggaaagaggtggagctggagatccggatacaggtggatgagctgatgcgtcaggagctgaggaagctccgtctggctgtggacaaggaggaaaaagacccctga
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.