GGRNA Home | Help | Advanced search

2020-10-26 19:38:23, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_003846770            4194 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens FERM and PDZ domain-containing protein
            3-like (LOC100996848), mRNA.
ACCESSION   XM_003846770
VERSION     XM_003846770.1  GI:397138686
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_001842391) annotated using gene prediction method: GNOMON,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4194
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /sex="male"
                     /dev_stage="adult"
     gene            1..4194
                     /gene="LOC100996848"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 1 mRNA, 1 EST, 1 Protein"
                     /db_xref="GeneID:100996848"
     CDS             1..4116
                     /gene="LOC100996848"
                     /codon_start=1
                     /product="FERM and PDZ domain-containing protein 3-like"
                     /protein_id="XP_003846818.1"
                     /db_xref="GI:397138687"
                     /db_xref="GeneID:100996848"
                     /translation="
MQEIILRSFSPISQCRLSMYHGSAIQAKLQYLRILNELPTFTGVLFNTVGLDEKQSATTLLVGPRHGISHVIDLKTNLTTVLSEFSKISKIQLFRENQGVARVETSIMDAKPLVLLMEWPEATNFACLIAGYCRLLLDSRKMVFSRPASQPLPPPMIKADYMHSAHRPVTGGHLGKKESSYVGSVGTSPRKSSRCTPPPADSELVSFCYLHMREQRKEQESRTDVNENLIFFEETRPRTKSDPTSKSSGQGYEVVPDDFDAASLDHEPCASRARSYTLDNSLGAEALNFYCDSCKAKLQSSWALANVQTRTVRDHAQELDDALVSTLQALEALAASEDGPHPPPPQTAGLIVLATITPESSLDSGHETNSSELTDMSEMMSAMKQHQNTTYFLAQHLNKDSLLARKDLPFRIQSCAAQAVLTAPYSLGRPDPNPSLQPIATGQSPGPPGARRKLPQSEGQVQGERTYSLAVHPALSPQLSEQKNLSLLSPVPEDKGPGHTRAGLEMSLRAATSSLSEEQVSELRDNLPKEVRLSPKLILDPKSSVTPAIISAALQQVVHNKSLVTAGGALGNPPSRGERRLEASMGRPEVSMMSSSASKNLKFKISPSAPETSWNSQHQLGAEVSSSPRAPTGSRADSLHLSQQEDSLPVQNFPPKSYLLRTSRESVGKQATGEVAGKGGPVGGKPTLQKQGTISSQGEKAQLESTPKRSKLEETSLVPRATYPMALQSPSCQSRSHSPSCQPHGHSPSSQSRGQSPSCQPRGQSPLRSQAASRQVSTMPSRKLETTLNGAHSTSEGPAKPKSSRGPFRLRNLFSATFPTRQKKETDERQAQLQKVKQYELEFLEELLKPPSQGELPGTEYLQPPAPGRCSCQLRSSPVQQGPGMSREQRRSCDCKRICRGGRPQATQTPVPSLRGRERDRVLPSQRQPEAGPGVSLSSPINVQRIRSTSLESRECRSDPESGVSCLTTCASGGECLGAPNYRKLMRRYSISELDQGDRASLTSDVYPHPPLGMLPREAKEVEASLPIALGPKSRSLESPTLGDPSYVQVAPETKGPRQMAVFSLPEEVYRKPAELDEDSESSKCCSIRYCFYYRKCDMADDASDGKDELSYSIPMKILPGMKLDEQVVPVVSRTLQVLDAATCSSSSPEASRTQEIDLRVSTFEGSLAKINALRAHAYGLPDGFLAARLDTNELLTVLRQCVASPEARAPKPYVSQISEYKLELALKFKELRASCRRVANVDKSPTHMLAAITGSFQVLSSLIETFVRLVFIVRSEAQRQELLAKVEEVVRNYTFLLRAAEESTARNLNQQQQQQQQQQQQQQQQQQQQQQQQQQQVAAAAGAATEHPPGSPTSATVMSTFTHSLKTLIK
"
     misc_feature    73..432
                     /gene="LOC100996848"
                     /note="FERM and PDZ domain containing proteins 1, 3, and 4
                     (FRMPD1, 3, 4) FERM domain C-lobe; Region:
                     FERM_C_FRMPD1_FRMPD3_FRMPD4; cd13183"
                     /db_xref="CDD:241337"
     misc_feature    order(148..150,208..210,214..216,238..240)
                     /gene="LOC100996848"
                     /note="putative phosphoinositide binding site [chemical
                     binding]; other site"
                     /db_xref="CDD:241337"
     misc_feature    order(250..252,268..279,376..378,388..390,397..402)
                     /gene="LOC100996848"
                     /note="putative peptide binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:241337"
     misc_feature    376..411
                     /gene="LOC100996848"
                     /note="putative actin binding site 2 [polypeptide
                     binding]; other site"
                     /db_xref="CDD:241337"
     variation       126
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137932679"
     variation       152
                     /gene="LOC100996848"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376425208"
     variation       180
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370791419"
     variation       403
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34409749"
     variation       492
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186977626"
     variation       536
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371411843"
     variation       540
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374674303"
     variation       575
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191464475"
     variation       613
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372050912"
     variation       660
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370166755"
     variation       713
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373975442"
     variation       747
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369440568"
     variation       759
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368170440"
     variation       777
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372982632"
     variation       821
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371922832"
     variation       912
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375326152"
     variation       927
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368777146"
     variation       978
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145396655"
     variation       1045
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371835150"
     variation       1056
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372062988"
     variation       1158
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369613160"
     variation       1342
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185843306"
     variation       1348
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191059172"
     variation       1352
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376522247"
     variation       1374
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199655203"
     variation       1503
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181763252"
     variation       1508
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370132530"
     variation       1581
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186103884"
     variation       1608
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373805434"
     variation       1679
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190679656"
     variation       1717
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200539181"
     variation       1733
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370622567"
     variation       1779
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374045884"
     variation       1910
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368183217"
     variation       1935
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372120953"
     variation       1978
                     /gene="LOC100996848"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202060665"
     variation       2080
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368156988"
     variation       2102
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368612181"
     variation       2103
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371578570"
     variation       2106
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183335708"
     variation       2274
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376036356"
     variation       2283
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188122545"
     variation       2408
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371957266"
     variation       2425
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375298972"
     variation       2426
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369738439"
     variation       2431
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373259744"
     variation       2432
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376386766"
     variation       2508
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369941771"
     variation       2576
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373481868"
     variation       2648
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148049673"
     variation       2674..2675
                     /gene="LOC100996848"
                     /replace="ag"
                     /replace="cc"
                     /db_xref="dbSNP:34637928"
     variation       2694
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190160063"
     variation       2721
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376909950"
     variation       2743
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370214613"
     variation       2748
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373240414"
     variation       2784
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372464381"
     variation       2850
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183198624"
     variation       2858
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187380964"
     variation       2916
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370910242"
     variation       2922
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375806865"
     variation       2923
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368320134"
     variation       3041
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192528349"
     variation       3054
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377184517"
     variation       3122
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371181317"
     variation       3152
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376134061"
     variation       3183
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367580716"
     variation       3222
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371522221"
     variation       3226
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376108129"
     variation       3231
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368141801"
     variation       3237
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371873767"
     variation       3333
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41305439"
     variation       3369
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369848619"
     variation       3376
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369595159"
     variation       3457
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373286272"
     variation       3600
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111780917"
     variation       3658
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375881611"
     variation       3709
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369146286"
     variation       3713
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372678985"
     variation       3728
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185438129"
     variation       3777
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377153221"
     variation       3805
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370528952"
     variation       3823
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373878659"
     variation       3828
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377611123"
     STS             3909..4079
                     /gene="LOC100996848"
                     /standard_name="STS-X85323"
                     /db_xref="UniSTS:57076"
     variation       3949
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200957790"
     variation       3972..3973
                     /gene="LOC100996848"
                     /replace=""
                     /replace="cag"
                     /db_xref="dbSNP:201186557"
     variation       3972
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367997323"
     variation       3990
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41304446"
     variation       4064
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630117"
     variation       4065
                     /gene="LOC100996848"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141655380"
     variation       4133
                     /gene="LOC100996848"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370956101"
ORIGIN      
atgcaggagataattctcaggtccttttcaccaattagtcagtgccgactgagcatgtatcatggctctgcaattcaggcaaagctccagtatctacgaattctgaatgaacttcctaccttcacgggcgttttgttcaacactgtaggcctggatgagaagcagtcggccaccacgctcctggtgggaccccgtcatggcatcagccatgttattgacctcaaaaccaacctcaccactgtgctgtccgagttcagcaagatcagcaagatccagctgttccgggagaaccagggcgtggcccgggtggagaccagcatcatggatgccaagcctctggtgctgttgatggagtggcctgaagccaccaactttgcctgcctgatcgcggggtactgccgcctcttgctggattccaggaagatggtcttctccaggcctgccagccagccacttccacctccaatgatcaaggcagattacatgcacagcgcccaccgccctgtcactgggggccacctggggaaaaaggagagtagttatgtgggcagcgtgggcaccagccccaggaaatcgagccgctgcacgcccccacctgccgactctgagcttgtcagcttctgctacctccatatgcgggaacaaaggaaggagcaggaaagccggacagatgtcaacgagaacctaatcttctttgaggagaccaggccccgaaccaagtctgaccccacatccaaaagctctggccaaggttatgaggtagtccctgatgactttgatgcagctagcctagaccacgagccttgtgccagcagggcccggtcctacaccttggacaattcccttggggctgaagccctgaatttctactgtgactcttgcaaagccaaacttcagagcagctgggccctcgcaaatgtgcagacccggacagttcgagatcatgcccaggagctagatgatgccctggtgtccactctgcaggctctagaagccctggctgcatccgaggatggaccacacccaccacccccacagactgcaggtctgattgtgctggccacaatcactcctgaatcatcgctggactcaggtcatgaaaccaactcttcagagctcacagacatgtcagagatgatgtcggccatgaagcagcaccagaacaccacctacttcctggcccagcacctcaacaaggacagcctccttgcccgcaaggacctgcccttccggatccagagctgtgcagcccaggccgttcttacggccccttactctcttgggcgcccggatcccaacccatctctccaacccattgccacaggccagagtcctggcccccctggcgctcggaggaagctgccccagtcagagggccaggtacagggagaacgaacatactccttggcagtgcacccagcactgtccccacagcttagtgaacagaagaatctgagtctgctgtccccagttcctgaggacaaagggcctggccacactagggcaggcctagaaatgtcactgagggcagccacatcatccctcagtgaagagcaggtctctgagctgagggacaacctgcccaaggaggtcaggttgagccccaagcttatcctcgacccaaagagcagtgtgacccctgccatcatctcggccgccctacagcaagtggttcacaataagagtctagtcactgctggtggggctttggggaacccccccagcaggggtgagagaaggctggaggccagcatggggaggccagaggttagcatgatgagcagcagtgccagtaagaatctgaagttcaaaattagccccagtgctccagagacctcatggaattctcaacatcagctgggtgcagaggtctcttccagccccagagcacccacaggcagccgggctgacagcctgcacctctcccaacaagaggacagtctgcctgttcaaaatttccctcccaaaagctatcttttgcgaacaagccgagagtcagtgggcaagcaagctacaggggaggtggcaggcaaaggcgggccagtgggtggtaagcccaccctgcagaagcagggcaccatctccagccaaggggagaaggcgcagctggagagcacacccaaaagaagcaagctcgaagagaccagcctggttccccgagctacctaccccatggctctgcagagccccagctgccagtcaagaagccacagccccagctgccagcctcatggccacagccccagcagccagtctcgaggtcagagccccagctgccaacctcgaggccagagcccactgaggtctcaggctgccagccggcaggtgagcaccatgccctctaggaagcttgaaacaactctcaatggagcccactcgacctctgaaggccctgccaaacccaagtcatcccgaggtcctttccggctacgcaatttattctctgccaccttcccaacccgccagaagaaggagacagatgagcggcaggcccaactgcagaaggtaaagcagtatgaactggagttccttgaggaacttctaaagccaccaagccagggggagctgccaggcaccgagtacctgcaacctccagcacctggccgctgcagctgccagctccgcagcagccctgtgcagcaggggcctggcatgtcccgtgagcagaggcgcagctgtgactgcaagcgcatctgccgggggggccggccacaagccacccagacaccagtgcccagcctccgggggagggaaagggacagagtcctccctagccagaggcagccagaggctggcccaggcgtgagcctcagcagccccatcaatgtccagcgcattcgttctaccagcctggagtcccgagagtgccgatcggaccctgagagtggtgtttcgtgcctgaccacgtgtgcctcggggggcgagtgtctgggagctcccaattacaggaaactgatgcgccgctacagtatcagtgagctggaccagggtgacagggcctcgctgacctcggatgtctacccacatcctcccctgggcatgctgcccagggaggccaaggaggtagaggcaagcctccccatagccttgggtcccaaaagcaggtctctggagtcaccgacgctgggagacccctcctacgtccaggttgccccagagaccaaaggccccagacagatggccgtgttctcactgcccgaggaggtgtaccggaagcctgccgagctagacgaggacagtgagagcagcaagtgctgctccatccgctactgcttctactaccgcaagtgtgacatggcagatgatgccagtgatggcaaggatgagctctcctactctatccccatgaagatcctgcctggcatgaagctggacgagcaggtggtgcctgtggtgagcaggaccctgcaggtgctggatgctgctacctgcagcagcagcagccctgaggcctcccgcactcaggagattgacctccgtgtgtccaccttcgaggggagcctggccaagatcaatgccctgcgggcccatgcctatggcctccctgatggcttcctggctgcccggctggacaccaacgagctgctgacagtcctgcggcagtgtgtggccagccccgaggcccgtgcccccaagccctatgtgtctcagatctccgagtataagcttgagctagctctcaagttcaaggagctccgggcctcctgccgccgtgtggccaatgtggacaagagcccaactcacatgctggcagccatcacgggcagcttccaggtgctgagcagcctcattgagaccttcgtgcggctggtgttcattgtgcgctccgaggcccagcgccaagagctgctggccaaggtagaagaggtggtgaggaactacaccttcctgctgcgtgcagctgaggagtccacagcccgtaaccttaaccagcagcagcagcaacaacaacagcagcagcagcaacaacaacagcagcagcaacaacaacagcagcagcagcagcagcaggtggcagcagctgcaggggcagccacagagcatccaccaggctccccaacttcggcgactgttatgagcacattcacccactccttaaaaacccttattaagtagggcatctgcccacacctgtcccccttccccaaccatggccccaggtttgagctttgtggtccttgcatcttgtggtga
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.