LOCUS       XM_003403879            1245 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens liver carboxylesterase 1-like
            (LOC100653057), mRNA.
ACCESSION   XM_003403879
VERSION     XM_003403879.3  GI:410171035
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_003315945) annotated using gene prediction method: GNOMON,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 30, 2012 this sequence version replaced gi:397140248.
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1245
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16q12.2"
     gene            1..1245
                     /gene="LOC100653057"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 122 ESTs, 1 Protein"
                     /db_xref="GeneID:100653057"
     CDS             1..1047
                     /gene="LOC100653057"
                     /codon_start=1
                     /product="liver carboxylesterase 1-like"
                     /protein_id="XP_003403927.3"
                     /db_xref="GI:410171036"
                     /db_xref="GeneID:100653057"
                     /translation="

MPKKEATVFVTVLSPLAKNLFHRAISESGVALTSVLVKKGDVKPLAEQIAITAGCKTTTSAVMVHCLRQKTEEELLETTLKMKFLSLDLQGDPRESQPLLGTVIDGMLLLKTPEELQAERNFHTVPYMVGINKQEFGWLIPMQLMSYPLSEGQLDQKTAMSLLWKSYPLVCIAKELIPEATEKYLGGTDDTVKKKDLFLDLIADVMFGVPSVIVARNHRDAGAPTYMYEFQYRPSFSSDMKPKTVIGDHGDELFSVFGAPFLKEGASEEEIRLSKMVMKFWANFARNGNPNGEGLPHWPEYNQKEGYLQIGANTQAAQKLKDKEVAFWTNLFAKKAVEKPPQTEHIEL

"
     misc_feature    <16..957
                     /gene="LOC100653057"
                     /note="Esterases and lipases (includes fungal lipases,
                     cholinesterases, etc.)  These enzymes act on carboxylic
                     esters (EC: 3.1.1.-). The catalytic apparatus involves
                     three residues (catalytic triad): a serine, a glutamate or
                     aspartate and a histidine.These...; Region:
                     Esterase_lipase; cl12031"
                     /db_xref="CDD:214205"
     misc_feature    order(16..18,490..492,502..507,604..606,748..750,757..759)
                     /gene="LOC100653057"
                     /note="substrate binding pocket [chemical binding]; other
                     site"
                     /db_xref="CDD:29383"
     misc_feature    <34..984
                     /gene="LOC100653057"
                     /note="Carboxylesterase family; Region: COesterase;
                     pfam00135"
                     /db_xref="CDD:201026"
     misc_feature    order(403..405,745..747)
                     /gene="LOC100653057"
                     /note="catalytic triad [active]"
                     /db_xref="CDD:29383"
     STS             926..1152
                     /gene="LOC100653057"
                     /standard_name="RH11630"
                     /db_xref="UniSTS:42950"
     variation       complement(993)
                     /gene="LOC100653057"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3204526"
ORIGIN      

atgcccaagaaggaggcgacagtctttgtgactgttttgtctccattggccaagaacctcttccaccgggccatttctgagagtggcgtggccctcacttctgttctggtgaagaaaggtgatgtcaagcccttggctgagcaaattgctatcactgctgggtgcaaaaccaccacctctgctgtcatggttcactgcctgcgacagaagacggaagaggagctcttggagacgacattgaaaatgaaattcttatctctggacttacagggagaccccagagagagtcaaccccttctgggcactgtgattgatgggatgctgctgctgaaaacacctgaagagcttcaagctgaaaggaatttccacactgtcccctacatggtcggaattaacaagcaggagtttggctggttgattccaatgcagttgatgagctatccactctccgaagggcaactggaccagaagacagccatgtcactcctgtggaagtcctatccccttgtttgcattgctaaggaactgattccagaagccactgagaaatacttaggaggaacagacgacactgtcaaaaagaaagacctgttcctggacttgatagcagatgtgatgtttggtgtcccatctgtgattgtggcccggaaccacagagatgctggagcacccacctacatgtatgagtttcagtaccgtccaagcttctcatcagacatgaaacccaagacggtgataggagaccacggggatgagctcttctccgtctttggggccccatttttaaaagagggtgcctcagaagaggagatcagacttagcaagatggtgatgaaattctgggccaactttgctcgcaatggaaaccccaatggggaagggctgccccactggccagagtacaaccagaaggaagggtatctgcagattggtgccaacacccaggcggcccagaagctgaaggacaaagaagtagctttctggaccaacctctttgccaagaaggcagtggagaagccaccccagacagaacacatagagctgtgaatgaagatccagccggccttgggagcctggaggagcaaagactggggtcttttgcgaaagggattgcaggttcagaaggcatcttaccatggctggggaattgtctggtggtggggggcaggggacagaggccatgaaggagcaagttttgtatttgtgacctcagctttgggaataaaggatcttttgaaggccaaa

//