2024-04-18 03:21:48, GGRNA : RefSeq release 60 (20130726)
LOCUS XM_003403879 1245 bp mRNA linear PRI 30-OCT-2012 DEFINITION PREDICTED: Homo sapiens liver carboxylesterase 1-like (LOC100653057), mRNA. ACCESSION XM_003403879 VERSION XM_003403879.3 GI:410171035 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_003315945) annotated using gene prediction method: GNOMON, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Oct 30, 2012 this sequence version replaced gi:397140248. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1245 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="16" /map="16q12.2" gene 1..1245 /gene="LOC100653057" /note="Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 1 Protein" /db_xref="GeneID:100653057" CDS 1..1047 /gene="LOC100653057" /codon_start=1 /product="liver carboxylesterase 1-like" /protein_id="XP_003403927.3" /db_xref="GI:410171036" /db_xref="GeneID:100653057" /translation="
MPKKEATVFVTVLSPLAKNLFHRAISESGVALTSVLVKKGDVKPLAEQIAITAGCKTTTSAVMVHCLRQKTEEELLETTLKMKFLSLDLQGDPRESQPLLGTVIDGMLLLKTPEELQAERNFHTVPYMVGINKQEFGWLIPMQLMSYPLSEGQLDQKTAMSLLWKSYPLVCIAKELIPEATEKYLGGTDDTVKKKDLFLDLIADVMFGVPSVIVARNHRDAGAPTYMYEFQYRPSFSSDMKPKTVIGDHGDELFSVFGAPFLKEGASEEEIRLSKMVMKFWANFARNGNPNGEGLPHWPEYNQKEGYLQIGANTQAAQKLKDKEVAFWTNLFAKKAVEKPPQTEHIEL
" misc_feature <16..957 /gene="LOC100653057" /note="Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cl12031" /db_xref="CDD:214205" misc_feature order(16..18,490..492,502..507,604..606,748..750,757..759) /gene="LOC100653057" /note="substrate binding pocket [chemical binding]; other site" /db_xref="CDD:29383" misc_feature <34..984 /gene="LOC100653057" /note="Carboxylesterase family; Region: COesterase; pfam00135" /db_xref="CDD:201026" misc_feature order(403..405,745..747) /gene="LOC100653057" /note="catalytic triad [active]" /db_xref="CDD:29383" STS 926..1152 /gene="LOC100653057" /standard_name="RH11630" /db_xref="UniSTS:42950" variation complement(993) /gene="LOC100653057" /replace="a" /replace="g" /db_xref="dbSNP:3204526" ORIGIN
atgcccaagaaggaggcgacagtctttgtgactgttttgtctccattggccaagaacctcttccaccgggccatttctgagagtggcgtggccctcacttctgttctggtgaagaaaggtgatgtcaagcccttggctgagcaaattgctatcactgctgggtgcaaaaccaccacctctgctgtcatggttcactgcctgcgacagaagacggaagaggagctcttggagacgacattgaaaatgaaattcttatctctggacttacagggagaccccagagagagtcaaccccttctgggcactgtgattgatgggatgctgctgctgaaaacacctgaagagcttcaagctgaaaggaatttccacactgtcccctacatggtcggaattaacaagcaggagtttggctggttgattccaatgcagttgatgagctatccactctccgaagggcaactggaccagaagacagccatgtcactcctgtggaagtcctatccccttgtttgcattgctaaggaactgattccagaagccactgagaaatacttaggaggaacagacgacactgtcaaaaagaaagacctgttcctggacttgatagcagatgtgatgtttggtgtcccatctgtgattgtggcccggaaccacagagatgctggagcacccacctacatgtatgagtttcagtaccgtccaagcttctcatcagacatgaaacccaagacggtgataggagaccacggggatgagctcttctccgtctttggggccccatttttaaaagagggtgcctcagaagaggagatcagacttagcaagatggtgatgaaattctgggccaactttgctcgcaatggaaaccccaatggggaagggctgccccactggccagagtacaaccagaaggaagggtatctgcagattggtgccaacacccaggcggcccagaagctgaaggacaaagaagtagctttctggaccaacctctttgccaagaaggcagtggagaagccaccccagacagaacacatagagctgtgaatgaagatccagccggccttgggagcctggaggagcaaagactggggtcttttgcgaaagggattgcaggttcagaaggcatcttaccatggctggggaattgtctggtggtggggggcaggggacagaggccatgaaggagcaagttttgtatttgtgacctcagctttgggaataaaggatcttttgaaggccaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.